AGAC Chain for L.acidipiscis



Entity Query:

序号 PMID SentID Sentence Chian
1 16825650 10098 The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities.
  1. L. acidipiscis→ThemeOf→rpoA
  2. L. acidipiscis→ThemeOf→atpA
  3. rpoA→ThemeOf→L. acidipiscis
  4. atpA→ThemeOf→L. acidipiscis
2 17696886 192 After frozen storage (-20 to -30 C for 5-8 weeks), C. divergens and C. maltaromaticum seem to be particularly prominent in chilled MAP fish, as has been reported for cod, garfish, salmon, and tuna.
  1. C. maltaromaticum→CauseOf→prominent
3 17696886 222 Thus, amino acid substitutions closer to the N-terminus in carnobacteriocin B2 drastically reduced or eliminated antimicrobial activity, whereas this was not so for substitutions close to the C-terminal part.
  1. substitutions→CauseOf→eliminated
  2. substitutions→CauseOf→reduced
  3. reduced→CauseOf→eliminated
  4. eliminated→CauseOf→reduced
4 17696886 226 Chemical oxidation of tryptophan residues by N-bromosuccinimide showed that these residues were crucial for inhibitory activity, as modification of any one of them rendered divercin V41 inactive.
  1. inhibitory activity→ThemeOf→rendered
  2. inhibitory activity→ThemeOf→divercin
  3. inhibitory activity→ThemeOf→modification
  4. inhibitory activity→ThemeOf→inactive
  5. modification→CauseOf→rendered
  6. rendered→CauseOf→inactive
  7. modification→ThemeOf→divercin
  8. divercin→ThemeOf→rendered
  9. modification→ThemeOf→inhibitory activity
  10. divercin→ThemeOf→inhibitory activity
  11. modification→CauseOf→inactive
  12. divercin→ThemeOf→modification
  13. inactive→CauseOf→rendered
  14. divercin→ThemeOf→inactive
5 17696886 256 Therefore, it has been suggested that a C. divergens strain in which the tyrosine decarboxylase gene is inactivated by mutagenesis could be used as a protective culture to prevent growth of L. monocytogenes in cold-smoked salmon.
  1. tyrosine→ThemeOf→inactivated
  2. tyrosine→ThemeOf→mutagenesis
  3. growth→ThemeOf→tyrosine
  4. growth→ThemeOf→inactivated
  5. growth→ThemeOf→mutagenesis
  6. mutagenesis→ThemeOf→tyrosine
  7. mutagenesis→ThemeOf→growth
  8. mutagenesis→CauseOf→inactivated
  9. tyrosine→ThemeOf→growth
6 17696886 286 Production by C. maltaromaticum of alcohols and aldehydes from valine, leucine and/or isoleucine resulted in a malty, green aroma in skimmed milk and shrimp, and has also caused spoilage of cured ham (Table 4).
  1. isoleucine→CauseOf→caused
  2. resulted in→CauseOf→caused
  3. isoleucine→CauseOf→resulted in
  4. caused→CauseOf→resulted in
7 17696886 307 Finally, C. maltaromaticum has been shown to cause a softer texture of salmon fillets when inoculated in high numbers.
  1. C. maltaromaticum→CauseOf→cause
  2. C. maltaromaticum→ThemeOf→softer
  3. softer→ThemeOf→C. maltaromaticum
  4. softer→ThemeOf→cause
8 17696886 333 It is, therefore, not surprising that C. maltaromaticum and C. maltaromaticum-like strains are also found in the intestine or gills of healthy fish, including Arctic charr, Atlantic cod, Atlantic salmon, brown bullhead, trout, and various freshwater fish.
  1. C. maltaromaticum-like→CauseOf→found
9 17696886 339 Carnobacterium divergens and C. maltaromaticum enhance the cellular and humoral immune responses and cytokine expression ratios of rainbow trout.
  1. C. maltaromaticum→CauseOf→enhance
10 17696886 344 This specific case of pathogenesis is probably best understood as a result of opportunistic infection, although C. maltaromaticum (but not C. divergens, C. gallinarum, C. inhibens, C. mobile or C. viridans) exerts chitinolytic acitivity (Leisner & Ingmer, unpublished data), a feature that can be perceived as targeting the chitin-containing exoskeleton of insects.
  1. C. maltaromaticum→CauseOf→exerts
11 17696886 360 This may, in some instances, be due to faulty methodology for detecting carnobacteria.
  1. carnobacteria→ThemeOf→faulty
  2. faulty→ThemeOf→carnobacteria
12 18048734 412 The DNA G+C content of their closest relatives, L. salivarius JCM 1231T and L. aviarius subsp.
  1. DNA G+C content→ThemeOf→L. salivarius
  2. L. salivarius→ThemeOf→DNA G+C content
13 18048734 418 Since KBL13T and GBL13 were found to be the same species, KBL13T was used as a representative strain in the experiments described below.
  1. KBL13T→ThemeOf→GBL13
  2. GBL13→ThemeOf→KBL13T
14 18048734 421 DNA-DNA relatedness values between KBL13T and L. salivarius JCM 1231T and JCM 1150, and L. aviarius subsp.
  1. JCM 1231T→ThemeOf→DNA-DNA relatedness
  2. DNA-DNA relatedness→ThemeOf→JCM 1231T
15 19783610 10105 Furthermore, the new isolates could be differentiated clearly from L. acidipiscis NBRC 102163T and NBRC 102164 in terms of acid production from L-arabinose, rhamnose, mannitol, lactose and 5-ketogluconate.
  1. mannitol→ThemeOf→rhamnose
  2. lactose→ThemeOf→rhamnose
  3. acid production from L-arabinose→ThemeOf→NBRC 102163T
  4. NBRC→CauseOf→mannitol
  5. NBRC 102163T→ThemeOf→mannitol
  6. acid production from L-arabinose→ThemeOf→mannitol
  7. NBRC→CauseOf→acid production from L-arabinose
  8. NBRC 102163T→ThemeOf→acid production from L-arabinose
  9. acid production from L-arabinose→ThemeOf→lactose
  10. NBRC→CauseOf→lactose
  11. NBRC 102163T→ThemeOf→lactose
  12. acid production from L-arabinose→CauseOf→NBRC
  13. NBRC→CauseOf→rhamnose
  14. NBRC 102163T→ThemeOf→rhamnose
  15. acid production from L-arabinose→ThemeOf→rhamnose
  16. rhamnose→ThemeOf→NBRC 102163T
  17. mannitol→ThemeOf→NBRC 102163T
  18. lactose→ThemeOf→NBRC 102163T
  19. rhamnose→ThemeOf→mannitol
  20. mannitol→ThemeOf→acid production from L-arabinose
  21. lactose→ThemeOf→mannitol
  22. rhamnose→ThemeOf→acid production from L-arabinose
  23. mannitol→ThemeOf→lactose
  24. lactose→ThemeOf→acid production from L-arabinose
  25. rhamnose→ThemeOf→lactose
  26. mannitol→CauseOf→NBRC
  27. lactose→CauseOf→NBRC
  28. rhamnose→CauseOf→NBRC
16 21603260 453 on the basis of the results of 16S rDNA phylogenetic analyses, the genus Weissella encompasses a phylogenetically coherent group of lactic acid bacteria and includes twelve validated Leuconostoc-like species, currently, including W. confusa (formerly Lactobacillus confusus), W. minor (formerly Lactobacillus minor), W. kandleri (formerly Lactobacillus kandleri), W. halotolerans (formerly Lactobacillus halotolerans), W. viridescens (formerly Lactobacillus viridescens), Weissella paramesenteroides (formerly Leuconostoc paramesenteroides), W. hellenica, W. thailandensis, W. cibaria, Weissella kimchii, Weissella soil, and Weissella koreensis.
  1. Weissella→CauseOf→genus Weissella
  2. genus Weissella→CauseOf→Weissella
17 21995520 589 This was far higher than cellobiose, the other beta-glucoside tested, although the final pH of both cultures was very similar, and the medium was buffered in the same way as MRS. A high-quality draft genome sequence was generated for L. ruminis ATCC 25644 and a finished genome sequence was generated for ATCC 27782, as described in Methods.
  1. ATCC 25644→ThemeOf→MRS
  2. MRS→ThemeOf→ATCC 25644
18 21995520 606 The amino acid sequence of BglB and BglB2 showed 70% and 77% identity to the beta-glucosidases identified in the genomes of L. helveticus DPC 4571 and L. ultunensis DSM 16047, respectively.
  1. BglB2→ThemeOf→DPC
  2. BglB→ThemeOf→DPC
  3. DPC→ThemeOf→BglB
  4. DPC→ThemeOf→BglB2
19 21995520 649 The bovine L. ruminis isolates, ATCC 27780T, 27781 and 27782 were previously reported to utilise beta-glucan hydrolysates as a carbohydrate source, and in that study, all bovine isolates utilised beta-glucan hydrolysates of DP3, and only ATCC 27780T was unable to utilise DP4 oligosaccharide.
  1. ATCC→CauseOf→DP3
  2. ATCC→CauseOf→utilised
  3. utilised→CauseOf→ATCC
  4. DP3→CauseOf→ATCC
20 21995520 650 ATCC 27781 was distinguished by being able to utilise the highest percentage of both DP3 and DP4 beta glucan.
  1. DP3→ThemeOf→ATCC
  2. DP4→ThemeOf→ATCC
  3. ATCC→ThemeOf→DP3
  4. ATCC→ThemeOf→DP4
21 21995520 655 In addition, L. ruminis was capable of moderate to strong fermentation of Raftilose Synergy 1, an oligofructose-enriched inulin.
  1. fermentation→ThemeOf→Raftilose
  2. Raftilose→ThemeOf→fermentation
22 21995520 684 The Artemis program was used to visualise and identify carbohydrate metabolism genes in the genome of Lactobacillus ruminis ATCC 25644 and ATCC 27782.
  1. ATCC→CauseOf→carbohydrate metabolism genes
  2. carbohydrate metabolism genes→CauseOf→ATCC
23 22515692 10120 cremoris, Leuconostoc pseudomesenteroides, Pediococcus acidilactici, Pediococcus pentosaceus, Weissella hellenica, Weissella paramesenteroides and Carnobacterium divergens.
  1. Leuconostoc pseudomesenteroides→CauseOf→Weissella
  2. Leuconostoc pseudomesenteroides→CauseOf→Weissella
  3. Weissella→CauseOf→Leuconostoc pseudomesenteroides
  4. Weissella→ThemeOf→Pediococcus
  5. Weissella→CauseOf→Leuconostoc pseudomesenteroides
  6. Weissella→ThemeOf→Pediococcus
  7. Pediococcus→ThemeOf→Weissella
  8. Pediococcus→ThemeOf→Weissella
24 22768237 728 The genes pox, orf2 and the sequence of insertion IS1297 exhibited DNA sequence identity percentages higher than 90% with genes found in Lactobacillus buchneri, Enterococcus faecalis and Leuconostoc sp., respectively (Table S3).
  1. DNA sequence identity→ThemeOf→orf2
  2. insertion→ThemeOf→Leuconostoc
  3. insertion→ThemeOf→pox
  4. Leuconostoc→ThemeOf→DNA sequence identity
  5. insertion→ThemeOf→DNA sequence identity
  6. Leuconostoc→ThemeOf→insertion
  7. insertion→ThemeOf→orf2
  8. pox→ThemeOf→DNA sequence identity
  9. orf2→ThemeOf→DNA sequence identity
  10. pox→ThemeOf→insertion
  11. orf2→ThemeOf→insertion
  12. DNA sequence identity→ThemeOf→Leuconostoc
  13. DNA sequence identity→ThemeOf→pox
  14. DNA sequence identity→ThemeOf→insertion
25 22768237 731 Plasmid pGL2 appears to be a RCR plasmid, as suggested by the homology of its replication gene to those of other known RCR plasmids, such as pWCFS102 of Lactobacillus plantarum, pYSI8 of Lactobacillus sakei (Figure 3) and pSSU1 of Streptococcus suis , all members of the rolling-circle replication pMV158 family.
  1. pGL2→ThemeOf→pYSI8
  2. pWCFS102→ThemeOf→pGL2
  3. pYSI8→ThemeOf→pGL2
  4. pGL2→ThemeOf→pWCFS102
26 22768237 744 The protein encoded by orf16 displayed 42% aa identity to N-acetylmuramoyl-L-alanine amidase of Streptococcus dysgalactiae and contains two main enzymatic domains: a glucosaminidase domain (pfam01832) and a cysteine/histidine-dependant amidohydrolase/peptidase (designated CHAP; pfam05257) domain.
  1. pfam01832→ThemeOf→orf16
  2. orf16→ThemeOf→pfam01832
27 22768237 753 Txn of L. garvieae exhibits the catalytic Glu-X-Glu sequence (residues 199 to 201 in Txn), the NAD binding sites Ser-Thr-Ser sequence (amino acids 156-158 in Txn) and a conserved Arg residue (residing at position 129 in Txn), characteristic of the CT-group of many mono-ADP-ribosyltransferases.
  1. Arg→ThemeOf→Txn
  2. Txn→ThemeOf→Glu-X-Glu
  3. Arg→ThemeOf→Txn
  4. Arg→ThemeOf→Glu-X-Glu
  5. Txn→ThemeOf→Arg
  6. Arg→ThemeOf→Txn
  7. Txn→ThemeOf→Glu-X-Glu
  8. Glu-X-Glu→ThemeOf→Txn
  9. Txn→ThemeOf→Arg
  10. Glu-X-Glu→ThemeOf→Txn
  11. Txn→ThemeOf→Glu-X-Glu
  12. Glu-X-Glu→ThemeOf→Txn
  13. Txn→ThemeOf→Arg
  14. Glu-X-Glu→ThemeOf→Arg
  15. Txn→ThemeOf→Glu-X-Glu
  16. Glu-X-Glu→ThemeOf→Txn
  17. Arg→ThemeOf→Txn
  18. Txn→ThemeOf→Arg
28 22808200 768 Transcriptome analysis revealed that motility genes were transcribed at a significantly higher level in motile L. ruminis ATCC27782 than in non-motile ATCC25644.
  1. ATCC27782→ThemeOf→transcribed
  2. ATCC27782→CauseOf→higher
  3. motility→ThemeOf→transcribed
  4. motility→ThemeOf→ATCC27782
  5. motility→ThemeOf→higher
  6. transcribed→ThemeOf→motility
  7. transcribed→ThemeOf→ATCC27782
  8. transcribed→ThemeOf→higher
  9. ATCC27782→ThemeOf→motility
29 22808200 777 Particular substitutions within this region enable selected flagellate alpha- and epsilon-proteobacterial pathogens, including H. pylori and C. jejuni, to evade immune-recognition without compromising their motility.
  1. flagellate→ThemeOf→enable
  2. evade immune-recognition→ThemeOf→substitutions
  3. evade immune-recognition→ThemeOf→enable
  4. evade immune-recognition→ThemeOf→flagellate
  5. substitutions→ThemeOf→evade immune-recognition
  6. substitutions→CauseOf→enable
  7. substitutions→ThemeOf→flagellate
  8. flagellate→ThemeOf→evade immune-recognition
  9. flagellate→ThemeOf→substitutions
30 22808200 789 Three other species of the L. salivarius clade tested, specifically L. ghanensis L489T, L. mali DSM20444T and L. nagelii DSM13675T were also motile.
  1. L. nagelii→ThemeOf→motile
  2. L489T→ThemeOf→motile
  3. L. mali DSM20444T→ThemeOf→motile
  4. motile→ThemeOf→L. nagelii
  5. motile→ThemeOf→L489T
  6. motile→ThemeOf→L. mali DSM20444T
  7. motile→ThemeOf→DSM20444T
  8. DSM20444T→ThemeOf→motile
31 22808200 792 Relative to the L. ruminis motility locus, other notable variations in the L. mali motility region include the inversion of the motAB gene pair, the absence of homologs for flaG and a potential negative regulator (LRC_15730/ANHS_518; see below) of motility gene expression and the presence of only one flagellin gene in a strain that is known to be motile.
  1. inversion→ThemeOf→absence
  2. motility→ThemeOf→inversion
  3. inversion→ThemeOf→presence
  4. motility→ThemeOf→motAB
  5. inversion→ThemeOf→motility
  6. motility→ThemeOf→absence
  7. inversion→ThemeOf→LRC_15730
  8. motility→ThemeOf→presence
  9. motAB→ThemeOf→inversion
  10. motility→ThemeOf→LRC_15730
  11. motAB→ThemeOf→absence
  12. LRC_15730→ThemeOf→inversion
  13. motAB→ThemeOf→presence
  14. LRC_15730→ThemeOf→absence
  15. motAB→ThemeOf→motility
  16. LRC_15730→ThemeOf→presence
  17. absence→ThemeOf→presence
  18. LRC_15730→ThemeOf→motility
  19. inversion→ThemeOf→motAB
  20. presence→ThemeOf→absence
32 22808200 803 To determine if L. ruminis ATCC25644 might regain motility in vivo, isogenic, rifampicin resistant ATCC25644 and ATCC27782 strains were individually fed to mice and were later recovered from their faeces.
  1. ATCC25644→ThemeOf→ATCC25644
  2. motility→ThemeOf→regain
  3. ATCC25644→ThemeOf→motility
  4. motility→ThemeOf→ATCC27782
  5. ATCC27782→ThemeOf→regain
  6. motility→CauseOf→ATCC25644
  7. ATCC27782→ThemeOf→ATCC25644
  8. ATCC27782→ThemeOf→motility
  9. ATCC25644→ThemeOf→ATCC25644
  10. ATCC25644→CauseOf→regain
  11. ATCC25644→ThemeOf→ATCC27782
  12. ATCC25644→CauseOf→motility
  13. ATCC25644→ThemeOf→regain
  14. motility→ThemeOf→ATCC25644
33 22808200 820 The following substitutions were made to prepare MRS media (500 ml) with alternative protein, phosphate and carbon sources: 9 g of Bactocasitone or Bactopeptone in place of peptone (5 g) and Lab Lemco powder (4 g); 1 g of beta-glycerophosphate in place of dipotassium hydrogen phosphate; 10 g of preferred carbohydrate in place of glucose.
  1. Bactocasitone→ThemeOf→preferred carbohydrate
  2. preferred carbohydrate→ThemeOf→Bactocasitone
34 22808200 837 Primer sequences were designed for groEL, fliM and LRC_15730 (Table S5).
  1. LRC_15730→ThemeOf→groEL
  2. groEL→ThemeOf→LRC_15730
35 22808200 839 Rifampicin-resistant L. ruminis ATCC25644 and L. ruminis ATCC27782 variants were produced by serially subculturing these strains in MRS media with increasing concentrations of rifampicin until bacteria resistant to 200 microg/ml rifampicin were recovered.
  1. ATCC27782→ThemeOf→variants
  2. variants→ThemeOf→ATCC27782
36 23443163 860 Different sets of target strains were used including common indicator strains employed by different laboratories in similar studies (e.g., Lactococcus lactis CNRZ 117, Lactobacillus sakei LMG 2313, Listeria innocua BL86/26, etc.
  1. LMG→ThemeOf→Listeria
  2. Listeria→ThemeOf→LMG
37 23443163 866 More precisely, the milk CFCS of L. lactis, as well as the MRS CFCSs of both E. faecium strains gave a "borderline" inhibition (i.e., less colonies of the target strain around the well) towards Porphyromonas gingivalis DSM 20709T.
  1. DSM 20709T→ThemeOf→Porphyromonas gingivalis
  2. DSM 20709T→CauseOf→less
  3. Porphyromonas gingivalis→ThemeOf→less
  4. Porphyromonas gingivalis→ThemeOf→DSM 20709T
  5. colonies→ThemeOf→Porphyromonas gingivalis
  6. Porphyromonas gingivalis→ThemeOf→colonies
38 23443163 868 More specifically, the MRS CFCS of L. fermentum ACA-DC 179 and milk CFCS of L. plantarum ACA-DC 269 were active against S. oralis LMG 14532T.
  1. LMG→CauseOf→active
39 23637931 977 The most abundant Lactobacillus species in ZC2 were L. brevis (26.5%), L. plantarum (3.4%), L. oris (3.4%), L. johnsonii (3.3%), L. amylovorus (3.2%), and L. fermentum (2.8%).
  1. Lactobacillus→ThemeOf→ZC2
  2. L. johnsonii→ThemeOf→ZC2
  3. L. johnsonii→ThemeOf→Lactobacillus
  4. ZC2→ThemeOf→L. johnsonii
  5. ZC2→ThemeOf→Lactobacillus
  6. Lactobacillus→ThemeOf→L. johnsonii
40 23637931 986 For instance, some of the abundant COG functions in ZC1 and/or ZC2 (Table 3), such as hydrolases and dehydrogenases (COG1012, COG1960, COG1028, COG0673 and COG0561) and proteins involved with carbohydrate transport and metabolism (COG0395, COG1175, COG1129, COG1109, COG2814 and COG2723), can be related directly to the dynamics and recycling power in the microbial community structure in a biomass degrading environment.
  1. COG0395→ThemeOf→ZC2
  2. COG1028→ThemeOf→ZC2
  3. COG1012→ThemeOf→ZC2
  4. ZC2→ThemeOf→COG0395
  5. ZC2→ThemeOf→COG1028
  6. ZC2→ThemeOf→COG1012
  7. ZC2→ThemeOf→COG0673
  8. COG0673→ThemeOf→ZC2
41 23637931 987 In addition, among the most abundant functions present in ZC1 and/or ZC2 metagenomes (Table 3), we found several COGs associated with bacterial efflux pumps (COG1132, COG0841, COG0534, COG1131 and COG1136), which are known to export substances such as antibiotics and toxic molecules.
  1. COG1132→CauseOf→associated
  2. COG1136→CauseOf→associated
  3. COG1131→CauseOf→associated
  4. COG0534→CauseOf→associated
  5. COG0841→CauseOf→associated
42 23637931 989 The 30 most abundant COG functions (Table 3) also include functions related to regulation in response to environmental stimuli such as histidine kinases and response regulators (COG0642 and COG0745) and transcriptional regulators (COG1609 and COG0583).
  1. histidine→ThemeOf→COG1609
  2. COG0642→ThemeOf→regulation
  3. COG0642→ThemeOf→histidine
  4. COG1609→ThemeOf→regulation
  5. COG1609→ThemeOf→histidine
  6. regulation→ThemeOf→histidine
  7. regulation→ThemeOf→COG0642
  8. regulation→ThemeOf→COG1609
  9. histidine→ThemeOf→regulation
  10. histidine→ThemeOf→COG0642
43 23637931 995 In addition, we were able to identify 65 predicted protein sequences containing the dockerin domain (pfam00404) and 36 predicted protein sequences with the cohesin domain (pfam00963) in the ZC1 metagenome.
  1. ZC1→ThemeOf→pfam00404
  2. dockerin→ThemeOf→pfam00404
  3. dockerin→ThemeOf→ZC1
  4. pfam00404→ThemeOf→dockerin
  5. pfam00404→ThemeOf→ZC1
  6. ZC1→ThemeOf→dockerin
44 23637931 1024 Among these overrepresented COGs are those associated with bacterial efflux pumps (COG 1132 and COG0534), which are abundant within the ZC1 and ZC2 metagenomes, as already noted above.
  1. associated→CauseOf→overrepresented
  2. COG→CauseOf→associated
  3. COG→CauseOf→overrepresented
  4. overrepresented→CauseOf→associated
  5. COG0534→CauseOf→associated
  6. COG0534→CauseOf→overrepresented
45 23637931 1026 Also, predicted genes related to phosphotransferase system (COG1455, COG1263 and COG1264) and to ABC-type transport systems (Table S6) are overrepresented in the ZC2 metagenome, revealing its high potential for sugar uptake.
  1. phosphotransferase system→ThemeOf→overrepresented
  2. phosphotransferase system→ThemeOf→ZC2
  3. COG1455→ThemeOf→phosphotransferase system
  4. COG1455→CauseOf→overrepresented
  5. COG1455→ThemeOf→ZC2
  6. ZC2→ThemeOf→phosphotransferase system
  7. ZC2→ThemeOf→COG1455
  8. ZC2→ThemeOf→overrepresented
  9. phosphotransferase system→ThemeOf→COG1455
46 23661478 1063 L. pobuzihii E100301T can produce l-lactic acid from l-arabinose, rhamnose, lactose, and 5-ketogluconate, but not from mannitol.
  1. E100301T→CauseOf→produce
  2. E100301T→ThemeOf→l-lactic acid
  3. l-lactic acid→ThemeOf→produce
  4. l-lactic acid→ThemeOf→E100301T
47 23700436 1084 In this setting, Lu-doh-huang is used for its antipyretic and diuretic effects and for detoxification, reduction of swelling, and gut decontamination as empiric treatment.
  1. Lu-doh-huang→CauseOf→reduction
48 23700436 1085 In addition, Lu-doh-huang induces apoptosis of Hep3B hepatoma cells, reduces inflammation in lipopolysaccharide-induced RAW264.7 cells, and has antioxidative properties.
  1. hepatoma→ThemeOf→Lu-doh-huang
  2. Lu-doh-huang→ThemeOf→inflammation
  3. hepatoma→ThemeOf→induces
  4. Lu-doh-huang→CauseOf→reduces
  5. Lu-doh-huang→CauseOf→induces
  6. Lu-doh-huang→ThemeOf→antioxidative
  7. induces→CauseOf→reduces
  8. inflammation→ThemeOf→Lu-doh-huang
  9. inflammation→ThemeOf→induces
  10. antioxidative→ThemeOf→reduces
  11. reduces→CauseOf→induces
  12. antioxidative→ThemeOf→Lu-doh-huang
  13. Lu-doh-huang→ThemeOf→hepatoma
  14. antioxidative→ThemeOf→induces
49 23700436 1086 In animal models, Lu-doh-huang exerts a protective effect on CCl4-induced hepatotoxicity in rats; induces the activities of NADPH-CYP reductase, glutathione S-transferase, superoxide dismutase, glutathione peroxidase, and catalase in Balb/c mice; significantly decreases plasma glucose, total cholesterol, and triglycerides; and inhibits tyrosinase activity in MDCK and A375 cells.
  1. Lu-doh-huang→CauseOf→induces
  2. Lu-doh-huang→CauseOf→inhibits
  3. Lu-doh-huang→CauseOf→decreases
50 23700436 1135 In addition, we performed PCA to characterize the microbial community succession of Lu-doh-huang (Fig.
  1. Lu-doh-huang→ThemeOf→microbial community succession
  2. microbial community succession→ThemeOf→Lu-doh-huang
51 23700436 1154 A key difference between these products is the type of fermentation used in their manufacture, that is, Lu-doh-huang undergoes strictly anaerobic fermentation (inside bamboo sections), whereas the production of Semen Sojae Praeparatum involves aerobic fermentation.
  1. Lu-doh-huang→CauseOf→undergoes
52 23700436 1162 Therefore, we speculate that the main purpose of the unique production process of Lu-doh-huang is to enable microbial enzymes secreted during fermentation to biotransform various components of the product.
  1. biotransform→ThemeOf→enable
  2. biotransform→ThemeOf→Lu-doh-huang
  3. Lu-doh-huang→ThemeOf→biotransform
  4. Lu-doh-huang→CauseOf→enable
53 24936378 1184 The molecular method used failed to determine the exact taxonomic status of BH0900 and AH3133.
  1. BH0900→ThemeOf→AH3133
  2. AH3133→ThemeOf→BH0900
54 24936378 1223 However, it was observed that Pseudomonas aeruginosa ATCC 27853 resisted the inhibitory potential as compared with the other indicator bacteria (Fig.
  1. ATCC 27853→CauseOf→resisted
55 24936378 1245 Furthermore, L-arabinose, D-xylose, D-mannose, mannitol, lactose, B-gentiobiose, maltose and saccharose were variously fermented.
  1. D-mannose→ThemeOf→L-arabinose
  2. mannitol→ThemeOf→L-arabinose
  3. D-mannose→ThemeOf→D-xylose
  4. mannitol→ThemeOf→D-xylose
  5. D-mannose→ThemeOf→mannitol
  6. L-arabinose→ThemeOf→D-mannose
  7. L-arabinose→ThemeOf→D-xylose
  8. L-arabinose→ThemeOf→mannitol
  9. D-xylose→ThemeOf→D-mannose
  10. D-xylose→ThemeOf→L-arabinose
  11. D-xylose→ThemeOf→mannitol
  12. mannitol→ThemeOf→D-mannose
56 24936378 1247 Cluster F), this cluster contained four strains of Lactobacillus sp., BH1611, BH1711, BH181 and BH1911.
  1. Lactobacillus→ThemeOf→BH1711
  2. Lactobacillus→ThemeOf→BH1611
  3. BH1711→ThemeOf→Lactobacillus
  4. BH1711→ThemeOf→BH1611
  5. BH1611→ThemeOf→Lactobacillus
  6. BH1611→ThemeOf→BH1711
57 24936378 1261 However, strain BH2422 (cluster H) was also unable to ferment D-arabinose.
  1. ferment D-arabinose→ThemeOf→BH2422
  2. ferment D-arabinose→ThemeOf→unable
  3. BH2422→CauseOf→unable
  4. BH2422→ThemeOf→ferment D-arabinose
58 24936378 1292 BH2122) inhibits strongly E. coli, Salmonella typhimurium and moderately inhibits Pseudomonas aeruginosa but is inactive towards Shigella sp.
  1. Salmonella→ThemeOf→inhibits
  2. BH2122→CauseOf→inhibits
  3. inhibits→CauseOf→inhibits
  4. inhibits→CauseOf→inhibits
  5. E. coli→ThemeOf→Salmonella
  6. Pseudomonas→ThemeOf→Salmonella
  7. E. coli→ThemeOf→inhibits
  8. Pseudomonas→ThemeOf→inhibits
  9. E. coli→ThemeOf→BH2122
  10. Pseudomonas→ThemeOf→BH2122
  11. E. coli→ThemeOf→inhibits
  12. Pseudomonas→ThemeOf→inhibits
  13. Salmonella→ThemeOf→E. coli
  14. BH2122→ThemeOf→E. coli
  15. Salmonella→ThemeOf→inhibits
  16. BH2122→ThemeOf→Salmonella
  17. Salmonella→ThemeOf→Pseudomonas
  18. BH2122→CauseOf→inhibits
  19. Salmonella→ThemeOf→BH2122
  20. BH2122→ThemeOf→Pseudomonas
59 24936378 1301 Overall, all isolates fermented maltose and cellobiose except Pediococcus acidilactici AH5255 (cluster E) and Pediococcus pentosaceus AH3433, AH3433A, AH3433B, AH3433C, AH3433D and AH3433E (cluster I).
  1. fermented→ThemeOf→AH3433C
  2. fermented→ThemeOf→AH3433B
  3. AH3433E→ThemeOf→fermented
  4. fermented→ThemeOf→AH3433A
  5. AH3433→CauseOf→fermented
  6. fermented→ThemeOf→AH5255
  7. AH3433D→ThemeOf→fermented
  8. AH3433A→ThemeOf→fermented
  9. AH3433C→ThemeOf→fermented
  10. AH5255→ThemeOf→fermented
  11. AH3433B→ThemeOf→fermented
  12. fermented→ThemeOf→AH3433E
  13. fermented→CauseOf→AH3433
  14. fermented→ThemeOf→AH3433D
60 24942190 4171 Amongst the subfamily of MOBV1 plasmids, three groups of oriT sequences, represented by plasmids pMV158, pT181, and p1414 were identified.
  1. pT181→ThemeOf→pMV158
  2. MOBV1→ThemeOf→pMV158
  3. pMV158→ThemeOf→pT181
  4. pMV158→ThemeOf→MOBV1
61 24942190 4200 The nick introduced by Rep or Tra/Mob proteins generates a free 3'-OH end, which acts as a primer for leading-strand synthesis in both cases, VGT and HGT.
  1. HGT→ThemeOf→VGT
  2. VGT→ThemeOf→HGT
  3. VGT→ThemeOf→Rep
  4. Rep→ThemeOf→VGT
62 24942190 4219 Although we have not performed any further search, a homolog of the pMV158-tetL determinant was found in the chromosome of Bacillus subtilis, whereas a cat gene, homologous to the one harbored by plasmids pC194 and pC221 has been described to be present in the chromosome of G+ bacteria, like Bacillus pumilus or Streptococcus pneumoniae, and even in the chromosome of Clostridium perfringens.
  1. pC221→CauseOf→found
63 24942190 4224 In vitro, the MobM-protein from pMV158 was able to relax supercoiled DNA from both plasmids.
  1. pMV158→ThemeOf→MobM-protein
  2. MobM-protein→ThemeOf→pMV158
64 24942190 4229 In general, we found a good correlation between the G + C content of RCR-plasmids and their respective hosts, with the exception of the staphylococcal plasmid pUB110 which has a G + C content close to 45%, making it a plasmid which has been considered more like a bacilli than a staphylococci replicon.
  1. G + C→ThemeOf→pUB110
  2. G + C content→ThemeOf→pUB110
  3. G + C content→ThemeOf→G + C
  4. pUB110→ThemeOf→G + C content
  5. pUB110→ThemeOf→G + C
  6. G + C→ThemeOf→G + C content
65 24942190 4245 It was believed that plasmids are DNA molecules that result from shuffling of various gene cassettes, evolving independently one of each other.
  1. shuffling→CauseOf→result
66 24942190 4252 A total of 97 sequences were manually identified upstream to their respective relaxase encoded genes (five of them exhibiting two different MOBV-related oriTs: pSTE1, pKKS285, pSCFS1, unnamed (GenBank Acc.
  1. pSCFS1→ThemeOf→pKKS285
  2. pKKS285→ThemeOf→pSCFS1
  3. pKKS285→ThemeOf→pSTE1
  4. pSTE1→ThemeOf→pKKS285
67 24942190 4260 It is more intriguing the finding that pC194 and DeltaoriT-Deltamob-derivatives of plasmids pUB110 and pTA1060 were efficiently mobilized by the mating apparatus of ICEBs1, but without the intervention of the ICEBs1 NicK relaxase.
  1. pC194→ThemeOf→pTA1060
  2. pTA1060→ThemeOf→pC194
68 24942190 4280 Eight mating-pair formation (MPF) types have been phylogenetically described; three of them, MPFFATA, MPFFA and MPFT were able to mobilize MOBV1 plasmids.
  1. mobilize MOBV1 plasmids→ThemeOf→MPFT
  2. mobilize MOBV1 plasmids→ThemeOf→MPFFATA
  3. MPFT→ThemeOf→mobilize MOBV1 plasmids
  4. MPFT→ThemeOf→MPFFATA
  5. MPFFATA→ThemeOf→mobilize MOBV1 plasmids
  6. MPFFATA→ThemeOf→MPFT
69 24942190 4283 MOBV1 relaxases are predominantly linked to RCR initiators of the three different subgroups: Rep_1 (PF01446), Rep_2 (PF01719), and Rep_trans (PF02486).
  1. Rep→ThemeOf→linked
  2. PF01446→ThemeOf→MOBV1
  3. Rep→ThemeOf→PF01446
  4. PF01446→CauseOf→linked
  5. Rep→ThemeOf→PF01719
  6. MOBV1→ThemeOf→PF01446
  7. Rep→ThemeOf→linked
  8. MOBV1→ThemeOf→PF01719
  9. Rep→ThemeOf→PF01446
  10. MOBV1→ThemeOf→linked
  11. Rep→ThemeOf→PF01719
  12. PF01719→ThemeOf→Rep
  13. Rep→ThemeOf→linked
  14. PF01719→ThemeOf→Rep
  15. PF01446→ThemeOf→Rep
  16. PF01719→ThemeOf→Rep
  17. Rep→ThemeOf→PF01446
  18. PF01446→ThemeOf→Rep
  19. PF01719→ThemeOf→MOBV1
  20. Rep→ThemeOf→PF01719
  21. PF01446→ThemeOf→Rep
  22. PF01719→CauseOf→linked
70 24942190 4304 Deletion of the region encompassing the ssoA led to accumulation of ssDNA intermediates and to plasmid instability, but the plasmids were still able to replicate.
  1. plasmid instability→ThemeOf→ssDNA intermediates
  2. plasmid instability→ThemeOf→Deletion
  3. plasmid instability→ThemeOf→accumulation
  4. ssDNA intermediates→ThemeOf→plasmid instability
  5. ssDNA intermediates→ThemeOf→Deletion
  6. ssDNA intermediates→ThemeOf→accumulation
  7. Deletion→ThemeOf→plasmid instability
  8. Deletion→ThemeOf→ssDNA intermediates
  9. Deletion→CauseOf→accumulation
71 25501479 10134 Moreover, the presence of a large number of mobile genetic elements within and flanking the motility operon of L. curvatus suggests recent horizontal transfer between members of two distinct Lactobacillus clades: L. acidipiscis in the L. salivarius clade and L. curvatus inthe L. sakei clade.
  1. L. acidipiscis→CauseOf→horizontal
  2. L. acidipiscis→ThemeOf→motility
  3. motility→ThemeOf→horizontal
  4. motility→ThemeOf→L. acidipiscis
72 25584532 1350 Apart from mobC and rlx coding for mobilization proteins, two additional genes (SMA_p0016 and SMA_p0017) encode a conserved hypothetical protein and a Fic family protein, respectively.
  1. SMA_p0017→ThemeOf→Fic
  2. Fic→ThemeOf→SMA_p0017
  3. Fic→ThemeOf→SMA_p0016
  4. SMA_p0016→ThemeOf→Fic
73 25584532 1352 We found a 2.5 kb region within a large genomic island of S. macedonicus ACA-DC 198 containing genes SMA_0309 and SMA_0310 that showed >= 98% identity with cadC and cadA of pAH82.
  1. cadA→ThemeOf→SMA_0309
  2. cadA→ThemeOf→SMA_0310
  3. SMA_0309→ThemeOf→cadA
  4. SMA_0310→ThemeOf→cadA
74 25918672 1510 Variants of the L. acidipiscis and L. rennini, represented by bands "h" and "k", respectively, were also detected in the product made in northeastern Thailand (lane 6).
  1. L. acidipiscis→ThemeOf→Variants
  2. Variants→ThemeOf→L. acidipiscis
  3. Variants→ThemeOf→L. rennini
  4. L. rennini→ThemeOf→Variants
75 26415554 1605 Fucose residues are present in oligosaccharides in milk and on erythrocyte surface antigens.
  1. Fucose→CauseOf→present
76 26415554 1614 A major class of surface proteins in Gram-positive bacteria are those anchored by sortase enzymes that recognize a highly conserved LPXTG sequence motif.
  1. sortase→ThemeOf→LPXTG
  2. LPXTG→ThemeOf→sortase
77 26415554 1646 16) including widespread IS families (IS3 is nearly universal), as well as sequences that selectively occur in particular niches (for example, IS91 in dairy L. casei and L. paracasei tolerans and IS481 in brewing L. paracollinoides, L. farraginis and P. inopinatus).
  1. IS91→CauseOf→occur
  2. IS481→CauseOf→occur
78 26415554 1684 These searches included the DUF1034, which is equivalent to the Fn1 domain of ScpA; the CHU_C model corresponding to the Fn2 domain; the PA domain; SLAP, which is an S layer-anchoring domain; and a manual inspection for LPXTG derivative sequence.
  1. DUF1034→ThemeOf→ScpA
  2. CHU→ThemeOf→ScpA
  3. CHU→ThemeOf→DUF1034
  4. ScpA→ThemeOf→CHU
  5. ScpA→ThemeOf→DUF1034
  6. DUF1034→ThemeOf→CHU
79 26783070 10138 L. plantarum showed a mucin adhesion rate similar to that of L. plantarum 299v and L. casei Shirota, while L. pentosus and L. acidipiscis had a lower mucin adhesion.
  1. mucin adhesion→ThemeOf→lower
  2. L. acidipiscis→ThemeOf→mucin adhesion
  3. L. acidipiscis→ThemeOf→mucin adhesion
  4. L. acidipiscis→CauseOf→lower
  5. mucin adhesion→ThemeOf→L. acidipiscis
  6. mucin adhesion→ThemeOf→mucin adhesion
  7. mucin adhesion→ThemeOf→lower
  8. mucin adhesion→ThemeOf→L. acidipiscis
  9. mucin adhesion→ThemeOf→mucin adhesion
80 26783070 10141 This is the first time that halotolerant lactic acid bacteria have been shown to have probiotic properties.
  1. halotolerant→ThemeOf→probiotic
  2. halotolerant→ThemeOf→lactic
  3. probiotic→ThemeOf→halotolerant
  4. probiotic→ThemeOf→lactic
  5. lactic→ThemeOf→halotolerant
  6. lactic→ThemeOf→probiotic
81 27743669 10147 Based on morphological and biochemical characteristics, and 16S rRNA gene sequence analysis, natural strains from both grasses were identified as L. plantarum, L. casei, Lactobacillus acidipiscis, Leuconostoc pseudomesenteroides, Leuconostoc garlicum, Weissella confusa, and Lactococcus lactis.
  1. Weissella→ThemeOf→Leuconostoc
  2. Leuconostoc→ThemeOf→Lactococcus
  3. Leuconostoc→ThemeOf→Weissella
  4. Lactococcus→ThemeOf→Weissella
  5. Lactococcus→ThemeOf→Leuconostoc
  6. Weissella→ThemeOf→Lactococcus
82 28028487 1726 This was an alternative procedure owing to the poor performance of pick_closed_otus.py, which reduced the overall number of OTUs in the cockatiel samples (Supplemental Information 1).
  1. number→ThemeOf→reduced
  2. number→ThemeOf→pick_closed_otus.py
  3. pick_closed_otus.py→CauseOf→reduced
  4. pick_closed_otus.py→ThemeOf→number
83 28028487 1748 The most common species (as best BLAST hits) for cockatiels are Lactobacillus coleohominis, L. reuteri and L. acidipiscis.
  1. L. reuteri→ThemeOf→Lactobacillus
  2. L. acidipiscis→ThemeOf→Lactobacillus
  3. Lactobacillus→ThemeOf→L. reuteri
  4. Lactobacillus→ThemeOf→L. acidipiscis
84 28261168 1901 This implies that co-existence of gadA and gadB in Lb.
  1. gadB→ThemeOf→gadA
  2. gadA→ThemeOf→gadB
85 28261168 1952 brevis GadA (WT) exhibited a significant (p < 0.05) activity than its two mutants with modifications to its N-terminus (Figure 4D).
  1. modifications→ThemeOf→activity
  2. activity→ThemeOf→modifications
86 28261168 1990 Moreover, transmembrane potential, which contributes to amino acid-dependent acid resistance in bacteria, could be increased by glutamate decarboxylation (Teixeira et al.,).
  1. glutamate decarboxylation→CauseOf→increased
  2. glutamate decarboxylation→ThemeOf→transmembrane potential
  3. glutamate decarboxylation→ThemeOf→amino acid-dependent acid resistance
  4. transmembrane potential→ThemeOf→increased
  5. amino acid-dependent acid resistance→ThemeOf→increased
  6. transmembrane potential→ThemeOf→decarboxylation
  7. amino acid-dependent acid resistance→ThemeOf→transmembrane potential
  8. transmembrane potential→ThemeOf→glutamate decarboxylation
  9. amino acid-dependent acid resistance→ThemeOf→decarboxylation
  10. transmembrane potential→ThemeOf→amino acid-dependent acid resistance
  11. amino acid-dependent acid resistance→ThemeOf→glutamate decarboxylation
  12. decarboxylation→CauseOf→increased
  13. decarboxylation→ThemeOf→transmembrane potential
  14. decarboxylation→ThemeOf→amino acid-dependent acid resistance
87 28261168 1996 brevis GadB demonstrated that these mutants extended their activities toward near-neutral acidity (Yu et al.,; Shi et al.,).
  1. mutants→ThemeOf→activities toward near-neutral acidity
  2. mutants→CauseOf→extended
  3. mutants→ThemeOf→GadB
  4. GadB→ThemeOf→activities toward near-neutral acidity
  5. GadB→ThemeOf→extended
  6. GadB→ThemeOf→mutants
  7. activities toward near-neutral acidity→ThemeOf→extended
  8. activities toward near-neutral acidity→ThemeOf→mutants
  9. activities toward near-neutral acidity→ThemeOf→GadB
88 28390025 10168 In addition, the Fourier transform infrared spectrophotometer data showed that functional groups such as C-H, O-H, C=O, and C-O-C which possibly associated with Pb2+ binding were mainly presented in the suspended solid portion of IC.
  1. C-O-C→CauseOf→associated
  2. C-O-C→CauseOf→presented
  3. associated→CauseOf→presented
  4. presented→CauseOf→associated
89 28399167 2033 Biochemically, the E. sibiricum 255-15 GtfC is very similar to L. reuteri GtfB, both cleaving (alpha1 4) linkages and introducing (alpha1 6) linkages in linear chains.
  1. GtfC→ThemeOf→introducing
  2. GtfC→ThemeOf→alpha1 6
  3. GtfC→ThemeOf→cleaving
  4. alpha1 6→ThemeOf→introducing
  5. alpha1 6→ThemeOf→GtfC
  6. alpha1 6→ThemeOf→cleaving
  7. alpha1 4) linkages→ThemeOf→introducing
  8. cleaving→ThemeOf→alpha1 4) linkages
  9. alpha1 4) linkages→ThemeOf→GtfC
  10. cleaving→CauseOf→introducing
  11. alpha1 4) linkages→ThemeOf→cleaving
  12. cleaving→ThemeOf→GtfC
  13. GtfC→ThemeOf→alpha1 4) linkages
  14. cleaving→ThemeOf→alpha1 6
90 28399167 2039 Instead of forming linear (alpha1 6) glucan chains, this enzyme was found to convert amylose into a branched and high molecular mass alpha-glucan with alternating (alpha1 4) and (alpha1 6) linkages.
  1. alpha1 6) linkages→CauseOf→convert
  2. alpha1 6) linkages→ThemeOf→amylose
  3. alpha1 4→CauseOf→convert
  4. alpha1 4→ThemeOf→amylose
  5. amylose→ThemeOf→alpha1 6) linkages
  6. amylose→ThemeOf→alpha1 4
  7. amylose→ThemeOf→convert
91 28399167 2052 The PCR primers used for amplifying the gtfD gene incorporated 5' extensions (in bold) to facilitate the ligation-independent (LIC) cloning and were: PbF (5 ' CAGGGACCCGGTGCGGAAAGCAATGCGAAAGG 3') and PbR (5 ' CGAGGAGAAGCCCGGTTAATTGCTAAACCGTCTTAATGCTTTATTC 3').
  1. gtfD→ThemeOf→PbR
  2. PbR→ThemeOf→gtfD
92 28399167 2078 One-dimensional 500-MHz 1H NMR spectra were recorded at a 4 000 Hz spectral width and 16k complex points, using a WET1D pulse to suppress the HOD signal.
  1. WET1D→ThemeOf→HOD signal
  2. HOD signal→ThemeOf→suppress
  3. HOD signal→ThemeOf→WET1D
  4. WET1D→CauseOf→suppress
93 28399167 2148 In accordance with its non-permuted domain organization, the order of these four conserved regions in P. beijingensis GtfD and other GtfD-like proteins is I-II-III-IV, instead of the permuted order II-III-IV-I characteristic of GH70 glucansucrases and GtfB-like 4,6-alpha-GTases.
  1. GtfD→ThemeOf→I-II-III-IV
  2. GtfB-like→ThemeOf→I-II-III-IV
  3. GH70→ThemeOf→I-II-III-IV
  4. I-II-III-IV→ThemeOf→GtfD
  5. I-II-III-IV→ThemeOf→GtfB-like
  6. I-II-III-IV→ThemeOf→GH70
94 28399167 2149 Among these seven residues, the nucleophile, the general acid/base and the transition state stabilizer of the catalytic triad were identified as Asp409, Glu442 and Asp512 in P. beijingensis GtfD (P. beijingensis GtfD numbering is used throughout unless indicated otherwise), respectively.
  1. GtfD→ThemeOf→Glu442
  2. GtfD→ThemeOf→Asp512
  3. Asp409→ThemeOf→GtfD
  4. Glu442→ThemeOf→GtfD
  5. Asp512→ThemeOf→GtfD
  6. GtfD→ThemeOf→Asp409
95 28399167 2152 Of note is the presence of a Tyr in GtfB, GtfC and GtfD proteins replacing the subsite +1/+2 Trp residue conserved in almost all GSs (W1065 in GTF180-DeltaN).
  1. GtfC→ThemeOf→Tyr
  2. GtfD→ThemeOf→W1065
  3. W1065→ThemeOf→GtfB
  4. GtfD→ThemeOf→Tyr
  5. W1065→ThemeOf→GtfC
  6. W1065→CauseOf→replacing
  7. W1065→ThemeOf→GtfD
  8. GtfB→ThemeOf→replacing
  9. Tyr→ThemeOf→GtfB
  10. GtfB→ThemeOf→W1065
  11. Tyr→ThemeOf→GtfC
  12. GtfB→ThemeOf→Tyr
  13. Tyr→CauseOf→replacing
  14. GtfC→ThemeOf→replacing
  15. Tyr→ThemeOf→GtfD
  16. GtfC→ThemeOf→W1065
  17. GtfD→ThemeOf→replacing
96 28399167 2153 A conserved Tyr is also present in the Lactobacillus fermentum GtfB active on (alpha1 4 glucans), but displaying (alpha1 3) linkage specificity suggesting that this residue may be considered a "sequence fingerprint" of GH70 proteins active on starch and maltodextrins.
  1. GtfB→ThemeOf→Tyr
  2. Tyr→ThemeOf→GtfB
97 28399167 2209 After treatment with pullulanase, the P. beijingensis GtfD and the A. chroococcum GtfD products were degraded into smaller oligosaccharides, reflecting the presence of alternating (alpha1 6)/(alpha1 4), and (alpha1 4,6) branching points in these polymers.
  1. degraded→CauseOf→presence
  2. presence→CauseOf→degraded
  3. alpha1 4,6→CauseOf→degraded
  4. alpha1 4,6→CauseOf→presence
98 28399167 2216 Compared with the A. chroococcum GtfD product the linear (alpha1 4)-linked sequences are longer in the P. beijingensis GtfD HMM polymer (up to DP6 in the model) and even longer in the P. beijingensis GtfD LMM polymer (up to DP8 in the model).
  1. P. beijingensis→CauseOf→longer
  2. P. beijingensis→CauseOf→longer
  3. longer→CauseOf→longer
  4. longer→CauseOf→longer
99 28399167 2247 Whereas most of the digestible fraction of the A. chroococcum GtfD-treated starch was hydrolyzed to glucose after 20 min, the rate of hydrolysis for P. beijingensis GtfD-treated starch continually increased over the 120 min of simulated intestinal digestion.
  1. GtfD-treated→ThemeOf→rate
  2. hydrolysis→ThemeOf→GtfD-treated
  3. hydrolysis→ThemeOf→increased
  4. rate→ThemeOf→GtfD-treated
  5. rate→ThemeOf→increased
  6. GtfD-treated→CauseOf→increased
  7. GtfD-treated→ThemeOf→hydrolysis
100 28399996 10174 In particular, esters, associated with fruity and floral notes, were positively correlated to L. paracollinoides, L. acidipiscis, and P. parvulus species.
  1. L. acidipiscis→CauseOf→correlated
101 28414739 2339 Here, an effort was made to assess whether any variations in these cell surface-related proteins can define the ecological niche preference of each individual L. ruminis strain.
  1. variations→CauseOf→define
  2. ecological niche preference→ThemeOf→define
  3. ecological niche preference→ThemeOf→variations
  4. variations→ThemeOf→ecological niche preference
102 28414739 2344 Here, it might be envisioned that active expression of the core gene annotated as fibronectin-binding protein (Fbp) (GRL1172_498, HMPREF0542_10570, LRC_RS05075, LRN_0851, PEL65_1842, PEL66_466, P869_04425, LRU_00261, and LRP_1613) might contribute to the gut autochthony of the various L. ruminis strains.
  1. LRP_1613→ThemeOf→gut autochthony
  2. gut autochthony→ThemeOf→GRL1172_498
  3. HMPREF0542_10570→CauseOf→contribute
  4. PEL65_1842→CauseOf→contribute
  5. gut autochthony→ThemeOf→PEL66_466
  6. HMPREF0542_10570→ThemeOf→gut autochthony
  7. PEL65_1842→ThemeOf→gut autochthony
  8. gut autochthony→ThemeOf→LRP_1613
  9. P869_04425→CauseOf→contribute
  10. LRN_0851→CauseOf→contribute
  11. gut autochthony→ThemeOf→PEL65_1842
  12. P869_04425→ThemeOf→gut autochthony
  13. LRN_0851→ThemeOf→gut autochthony
  14. gut autochthony→ThemeOf→LRN_0851
  15. GRL1172_498→CauseOf→contribute
  16. LRU_00261→CauseOf→contribute
  17. gut autochthony→ThemeOf→LRU_00261
  18. GRL1172_498→ThemeOf→gut autochthony
  19. LRU_00261→ThemeOf→gut autochthony
  20. gut autochthony→ThemeOf→LRC_RS05075
  21. PEL66_466→CauseOf→contribute
  22. gut autochthony→ThemeOf→contribute
  23. LRC_RS05075→CauseOf→contribute
  24. PEL66_466→ThemeOf→gut autochthony
  25. gut autochthony→ThemeOf→HMPREF0542_10570
  26. LRC_RS05075→ThemeOf→gut autochthony
  27. LRP_1613→CauseOf→contribute
  28. gut autochthony→ThemeOf→P869_04425
103 28414739 2364 Further, we noticed that this shortened LrpB primary structure results from an insertion of two adenines along the lrpB coding sequence, thus producing a reading-frameshift change.
  1. lrpB→ThemeOf→producing
  2. LrpB→ThemeOf→reading-frameshift change
  3. lrpB→ThemeOf→insertion
  4. LrpB→ThemeOf→producing
  5. reading-frameshift change→ThemeOf→lrpB
  6. LrpB→ThemeOf→insertion
  7. reading-frameshift change→ThemeOf→producing
  8. reading-frameshift change→ThemeOf→insertion
  9. reading-frameshift change→ThemeOf→LrpB
  10. insertion→ThemeOf→lrpB
  11. insertion→ThemeOf→reading-frameshift change
  12. insertion→CauseOf→producing
  13. lrpB→ThemeOf→reading-frameshift change
  14. insertion→ThemeOf→LrpB
104 28414739 2365 Relatedly, it is worth mentioning we had previously observed that for the DPC 6832-sourced LrpB pilin, there is a shift in the reading-frame of its deduced primary structure, which we found is due to a missing cytosine in a serine codon.
  1. LrpB→ThemeOf→missing
  2. LrpB→ThemeOf→shift
  3. missing→ThemeOf→LrpB
  4. missing→CauseOf→shift
105 28615683 2494 L. gallinarum DSM 10532, L. crispatus DSM 20584 and P. cellicola DSM 17757 were all found to harbour a NisC homolog, despite not being identified by BAGEL.
  1. NisC→ThemeOf→DSM 20584
  2. DSM 20584→ThemeOf→NisC
  3. DSM 20584→CauseOf→harbour
  4. DSM→CauseOf→NisC
  5. DSM→CauseOf→harbour
  6. DSM→CauseOf→NisC
  7. DSM→CauseOf→harbour
  8. NisC→CauseOf→DSM
  9. NisC→CauseOf→DSM
  10. NisC→ThemeOf→harbour
106 28615683 2508 Whilst the operons in O. kitaharae DSM 17330 and L. intestinalis DSM 6629 appear to be complete, the L. crispatus DSM 20584 TOMM operon appears to lack a structural gene, however, the structural gene for similar operons has been found to be some distance from the SagBCD homologs previously.
  1. SagBCD→ThemeOf→DSM 20584
  2. SagBCD→ThemeOf→lack
  3. DSM 20584→ThemeOf→SagBCD
  4. DSM 20584→ThemeOf→lack
107 28615683 2509 Of these three strains, L. crispatus DSM 20584 was the only one found to display antimicrobial activity; the source of such activity, however, remains unclear.
  1. DSM 20584→ThemeOf→antimicrobial activity
  2. antimicrobial activity→ThemeOf→DSM 20584
108 28615683 2518 While the source of antimicrobial activity from C. maltaromaticum DSM20342 is unclear, C. maltaromaticum DSM 20722 was found to produce the class IIa bacteriocin cbnB2 and cbnBM1, the class IId bacteriocin cbnX was also produced by the strain.
  1. DSM 20722→ThemeOf→cbnBM1
  2. DSM 20722→ThemeOf→cbnB2
  3. cbnBM1→ThemeOf→produce
  4. cbnBM1→ThemeOf→DSM 20722
  5. cbnB2→ThemeOf→produce
  6. cbnB2→ThemeOf→DSM 20722
  7. DSM 20722→CauseOf→produce
109 28615683 2520 Such bacteriocins tend to contain conserved GxxxG or AxxxA motifs which are responsible for close helix interactions between each bacteriocin peptide.
  1. AxxxA motifs→CauseOf→contain
  2. GxxxG→CauseOf→contain
110 28615683 2531 Leuconostoc mesenteroides TK41401 has also been shown to produce leucocyclicin Q, a subgroup I circular bacteriocin.
  1. leucocyclicin→ThemeOf→Leuconostoc
  2. TK41401→ThemeOf→Leuconostoc
  3. Leuconostoc→ThemeOf→leucocyclicin
  4. Leuconostoc→ThemeOf→TK41401
111 28615683 2540 L. equicursoris DSM 19284 is also highly likely to produce a novel class IId bacteriocin (equicursorin).
  1. DSM 19284→CauseOf→produce
112 28615683 2550 Two L. amylovorus strains (DSM 16698 and DSM 20531) were shown to produce a helveticin homolog.
  1. DSM 16698→CauseOf→produce
  2. DSM 16698→ThemeOf→helveticin homolog
  3. helveticin homolog→ThemeOf→produce
  4. helveticin homolog→ThemeOf→DSM 16698
  5. helveticin homolog→ThemeOf→DSM 20531
  6. DSM 20531→CauseOf→produce
  7. DSM 20531→ThemeOf→helveticin homolog
113 28615683 2591 paracasei DSM 5622 was grown overnight in MRS broth.
  1. DSM 5622→ThemeOf→paracasei
  2. paracasei→ThemeOf→DSM 5622
114 28651019 2626 Comparison of CRISPR arrays of L. pentosus MP-10 and phylogenetically related lactobacilli, such as L. plantarum, L. paraplantarum and L. brevis (available in CRISPRs database), showed that one DR consensus (5 -GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC-3 ) or its reverse complement was shared by all L. pentosus and L. plantarum strains except L. pentosus IG1 (Table 1).
  1. 5 -GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC-3→CauseOf→shared
115 28651019 2631 For example in CR1, we suggested that the primary invasion was accomplished by Haematospirillum jordaniae H5569 Plasmid unnamed 2, then by other short sequences followed by Borrelia miyamotoi FR64b Plasmid_07, and Clostridium taeniosporum 1/k Plasmid pCt3 (Table 2).
  1. Haematospirillum jordaniae H5569→ThemeOf→primary
  2. Haematospirillum jordaniae H5569→ThemeOf→FR64b
  3. primary→ThemeOf→Haematospirillum jordaniae H5569
  4. primary→ThemeOf→FR64b
  5. FR64b→ThemeOf→Haematospirillum jordaniae H5569
  6. FR64b→ThemeOf→primary
116 28651019 2639 Among the eight genes of CRISPR2, five of them were shared by both L. pentosus strains (MP-10 and KCA1): cas1, cas2, cas3, casC, cas5 and cse3 (Fig 3B); however, both unique genes for L. pentosus MP-10 (XX999_01589 gene ID, or cse1_Lpe gene, and XX999_01590 gene ID, or cse2_Lpe gene) corresponded to CRISPR-associated protein (KCA1_RS06550) and cse2/casB (KCA1_RS06555) in L. pentosus KCA1.
  1. KCA1_RS06550→ThemeOf→cse2/casB
  2. cse2/casB→ThemeOf→KCA1_RS06555
  3. cse2/casB→ThemeOf→KCA1_RS06550
  4. KCA1_RS06555→ThemeOf→cse2/casB
117 29942291 2696 Based on the presence/absence patterns of these genomic traits, strain ACA-DC 1533 seems to be more related to strain JCM 10692T than strain KCTC 13900.
  1. ACA-DC 1533→CauseOf→related
118 29942291 2699 Nonetheless, strain KCTC 13900 has a prophage that is absent from strains ACA-DC 1533 and JCM 10692T.
  1. KCTC 13900→CauseOf→absent
119 29942291 2709 Moreover, L. acidipiscis has also been found in vinegar and soy sauce, where it is considered to be a spoiler.
  1. L. acidipiscis→CauseOf→found
120 29942291 2724 Weissella kandleri DSM 20593T and Lactobacillus delbrueckii subsp.
  1. DSM 20593T→ThemeOf→Weissella
  2. DSM 20593T→ThemeOf→Lactobacillus
  3. Weissella→ThemeOf→DSM 20593T
  4. Lactobacillus→ThemeOf→DSM 20593T
121 29942291 2760 Core-genome analysis revealed that the motility operon is also present in strain JCM 10692T and flanked by the same genes (Supplementary Table S4B).
  1. JCM→ThemeOf→motility
  2. motility→ThemeOf→JCM
122 29942291 2764 It is interesting to note that GI 5 is present in strains ACA-DC 1533 and JCM 10692T but absent in KCTC 13900.
  1. ACA-DC→CauseOf→absent
  2. ACA-DC→ThemeOf→GI 5
  3. GI 5→ThemeOf→absent
  4. GI 5→ThemeOf→ACA-DC
123 29942291 2769 Furthermore, strain KCTC 13900 seems to have an intact prophage region (from now on called phage 3) of 40.8 Kbp length related also to Lactobacillus phages (Supplementary Table S6A).
  1. KCTC 13900→ThemeOf→Kbp
  2. Kbp→ThemeOf→KCTC 13900
124 29942291 2771 BLASTN analysis of all the spacers identified in these three CRISPR-Cas systems showed that several of them, namely spacers 9, 11, 13, 14, 19, 20, and 21 in CRISPR 1 and spacers 5, 14 and 21 in CRISPR 2 had hits in the Lactobacillus plantarum virulent phage phiJL-1.
  1. spacers→CauseOf→Lactobacillus plantarum
  2. spacers→CauseOf→hits
  3. spacers→CauseOf→Lactobacillus plantarum
  4. Lactobacillus plantarum→ThemeOf→hits
  5. Lactobacillus plantarum→CauseOf→spacers
  6. Lactobacillus plantarum→CauseOf→spacers
  7. spacers→CauseOf→hits
125 29942291 2772 Moreover, spacers 22 and 26 in CRISPR 2 had hits in L. salivarius plasmids.
  1. spacers→CauseOf→hits
126 29942291 2774 Thus, it could be hypothesized that strain KCTC 13900 has also been exposed to phage 1 or phage 2 but it was able to acquire immunity through its CRISPR-Cas systems.
  1. CRISPR-Cas→ThemeOf→acquire
  2. immunity→ThemeOf→acquire
  3. KCTC 13900→CauseOf→acquire
127 29942291 2803 Indeed, the carbohydrate fermentation profile of L. acidipiscis ACA-DC 1533 using the API 50 CHL stripes (Supplementary Table S12) and L. salivarius UCC118 showed that the two strains were able to ferment a number of carbohydrates of plant origin, i.e., L-arabinose, D-ribose, D-cellobiose, D-trehalose, D-glucose, D-fructose, D-mannitol, D-sorbitol, and D-saccharose.
  1. D-fructose→ThemeOf→D-sorbitol
  2. D-trehalose→ThemeOf→ferment
  3. L-arabinose→ThemeOf→D-fructose
  4. D-glucose→ThemeOf→L-arabinose
  5. D-saccharose→ThemeOf→CHL
  6. CHL→ThemeOf→D-fructose
  7. D-fructose→ThemeOf→L-arabinose
  8. D-trehalose→ThemeOf→D-saccharose
  9. L-arabinose→ThemeOf→D-trehalose
  10. D-glucose→ThemeOf→ferment
  11. D-saccharose→ThemeOf→D-fructose
  12. CHL→ThemeOf→D-trehalose
  13. D-fructose→ThemeOf→D-glucose
  14. D-sorbitol→ThemeOf→CHL
  15. L-arabinose→ThemeOf→D-sorbitol
  16. D-glucose→ThemeOf→D-saccharose
  17. D-saccharose→ThemeOf→D-trehalose
  18. CHL→ThemeOf→D-sorbitol
  19. D-fructose→ThemeOf→ferment
  20. D-sorbitol→ThemeOf→D-fructose
  21. L-arabinose→ThemeOf→D-glucose
  22. ferment→ThemeOf→CHL
  23. D-saccharose→ThemeOf→D-sorbitol
  24. CHL→ThemeOf→L-arabinose
  25. D-fructose→ThemeOf→D-saccharose
  26. D-sorbitol→ThemeOf→D-trehalose
  27. L-arabinose→ThemeOf→ferment
  28. ferment→ThemeOf→D-fructose
  29. D-saccharose→ThemeOf→L-arabinose
  30. CHL→ThemeOf→D-glucose
  31. D-trehalose→ThemeOf→CHL
  32. D-sorbitol→ThemeOf→L-arabinose
  33. L-arabinose→ThemeOf→D-saccharose
  34. ferment→ThemeOf→D-trehalose
  35. D-saccharose→ThemeOf→D-glucose
  36. CHL→ThemeOf→ferment
  37. D-trehalose→ThemeOf→D-fructose
  38. D-sorbitol→ThemeOf→D-glucose
  39. D-glucose→ThemeOf→CHL
  40. ferment→ThemeOf→D-sorbitol
  41. D-saccharose→ThemeOf→ferment
  42. CHL→ThemeOf→D-saccharose
  43. D-trehalose→ThemeOf→D-sorbitol
  44. D-sorbitol→ThemeOf→ferment
  45. D-glucose→ThemeOf→D-fructose
  46. ferment→ThemeOf→L-arabinose
  47. D-fructose→ThemeOf→CHL
  48. D-trehalose→ThemeOf→L-arabinose
  49. D-sorbitol→ThemeOf→D-saccharose
  50. D-glucose→ThemeOf→D-trehalose
  51. ferment→ThemeOf→D-glucose
  52. D-fructose→ThemeOf→D-trehalose
  53. D-trehalose→ThemeOf→D-glucose
  54. L-arabinose→ThemeOf→CHL
  55. D-glucose→ThemeOf→D-sorbitol
  56. ferment→ThemeOf→D-saccharose
128 29942291 2807 Similarly to what has been reported previously for L. salivarius UCC118 and according to our analysis, part of the glycobiome of both L. salivarius and L. acidipiscis ACA-DC 1533 resides in their plasmids.
  1. UCC118→ThemeOf→ACA-DC 1533
  2. ACA-DC 1533→ThemeOf→glycobiome
  3. ACA-DC 1533→ThemeOf→UCC118
  4. glycobiome→ThemeOf→UCC118
  5. glycobiome→ThemeOf→ACA-DC 1533
  6. UCC118→ThemeOf→glycobiome
129 29942291 2815 Interestingly, the Opp operon is present in L. acidipiscis ACA-DC 1533 and JCM 10692T but absent in KCTC 13900.
  1. ACA-DC→CauseOf→absent
  2. ACA-DC→ThemeOf→Opp operon
  3. Opp operon→ThemeOf→ACA-DC
  4. Opp operon→ThemeOf→absent
  5. Opp operon→ThemeOf→JCM
  6. JCM→CauseOf→absent
  7. JCM→ThemeOf→Opp operon
130 29942291 2817 However, it is worth noting that the DppD protein of L. acidipiscis KCTC 13900 is a potential pseudogene inactivating the entire Dpp system which deserves further investigation.
  1. KCTC→ThemeOf→Dpp system
  2. KCTC→CauseOf→inactivating
  3. Dpp system→ThemeOf→KCTC
  4. Dpp system→ThemeOf→inactivating
131 29942291 2822 The higher number of IS elements in the chromosome of L. acidipiscis ACA-DC 1533 may suggest a higher potential for genome plasticity compared to the L. salivarius UCC118 and L. ruminis ATCC 27782 chromosome.
  1. higher→CauseOf→higher
  2. higher→CauseOf→higher
  3. ACA-DC 1533→CauseOf→higher
  4. ACA-DC 1533→CauseOf→higher
132 29942291 2828 On the other hand, TFs contain TRs, OCSs, RRs and SFs.
  1. RRs→ThemeOf→TRs
  2. RRs→ThemeOf→OCSs
  3. TRs→ThemeOf→RRs
  4. OCSs→ThemeOf→RRs
133 29942291 2848 Furthermore, acetoin, which was produced by L. acidipiscis ACA-DC 1533, can be formed from pyruvate using two alternative pathways.
  1. ACA-DC 1533→ThemeOf→acetoin
  2. acetoin→ThemeOf→ACA-DC 1533
134 29942291 2849 Pyruvate, which derives from glycolysis, is converted into a-acetolactate by alpha-acetolactate synthase (LAC1533_RS03500).
  1. LAC1533_RS03500→ThemeOf→a-acetolactate
  2. a-acetolactate→ThemeOf→LAC1533_RS03500
135 29942291 2851 Finally, diacetyl/acetoin dehydrogenase (LAC1533_RS01560) catalyzes the conversion of diacetyl to acetoin.
  1. LAC1533_RS01560→ThemeOf→conversion of diacetyl to acetoin
  2. conversion of diacetyl to acetoin→ThemeOf→LAC1533_RS01560
136 29942291 2854 Given that L. acidipiscis ACA-DC 1533, along with L. rennini, were the only species found in Kopanisti cheese, the production of the above mentioned metabolites by L. acidipiscis ACA-DC 1533 via amino acid catabolism may contribute to the characteristic piquant flavor of Kopanisti cheese.
  1. piquant flavor→CauseOf→L. acidipiscis ACA-DC 1533
  2. L. acidipiscis ACA-DC 1533→CauseOf→contribute
  3. L. acidipiscis ACA-DC 1533→CauseOf→piquant flavor
137 30013519 2979 Interestingly, L. paracasei NFBC338 failed to produce futcin which was produced by E. coli.
  1. NFBC338→CauseOf→failed
138 30013519 2982 Interestingly, pediocin 20336a and hordeiocin inhibited the growth of a larger number of the indicators tested than pediocin PA-1.
  1. growth→CauseOf→pediocin
  2. hordeiocin→CauseOf→inhibited
  3. pediocin→CauseOf→inhibited
  4. pediocin→CauseOf→growth
139 30013519 3024 Futcin has a tryptophan residue at position 33 in the mature peptide; however this is not predicted to be involved in the stabilization of the hairpin fold; acidicin lacks a stabilizing terminal tryptophan residue altogether.
  1. acidicin→CauseOf→lacks
140 30013519 3026 Structural differences between these bacteriocins may not only affect their inhibitory activity but also may affect the ability of the pediocin transporter to secrete these bacteriocins.
  1. Structural→CauseOf→affect
  2. affect→CauseOf→affect
  3. affect→CauseOf→affect
  4. Structural→CauseOf→affect
141 30013519 3031 Pediocin, pediocin 20336a, rennicin A and rennicin B display between 84% and 93% homology to each other.
  1. pediocin→ThemeOf→rennicin A
  2. pediocin→ThemeOf→rennicin B
  3. rennicin A→ThemeOf→pediocin
  4. rennicin B→ThemeOf→pediocin
142 30013519 3033 Two amino acid substitutions in rennicin B may explain this as they occur in important structural regions for the bacteriocin.
  1. substitutions→ThemeOf→rennicin B
  2. substitutions→ThemeOf→bacteriocin
  3. rennicin B→ThemeOf→substitutions
  4. bacteriocin→ThemeOf→substitutions
143 30013519 3034 The Gly29-Ser29 substitution is found in the C-terminal alpha-helix of the peptide which is involved in membrane insertion.
  1. membrane insertion→ThemeOf→Gly29-Ser29
  2. membrane insertion→ThemeOf→involved
  3. found→CauseOf→involved
  4. Gly29-Ser29→ThemeOf→membrane insertion
  5. Gly29-Ser29→CauseOf→found
  6. Gly29-Ser29→CauseOf→involved
  7. involved→CauseOf→found
  8. membrane insertion→ThemeOf→found
144 30013519 3035 A Gly36-Ser36 substitution occurs in a double glycine motif which follows the alpha-helix.
  1. Gly36-Ser36→CauseOf→occurs
145 30013519 3036 This motif may provide the flexibility for the C-terminal tail to fold back upon the helix (Fimland et al.,), this flexibility may be lost due to the substitution with a larger serine residue.
  1. substitution→CauseOf→lost
146 30013519 3046 While duplications and false positives are likely to occur in these datasets, even if a small proportion of these genes can be analyzed using this expression system it represents a significant extension of the class II bacteriocins.
  1. duplications→ThemeOf→bacteriocin
  2. bacteriocin→ThemeOf→duplications
147 30628884 10188 The predominant fatty acids were C16 : 0, C18 : 1 omega9c and summed feature 8.
  1. C16→ThemeOf→summed feature
  2. C18→ThemeOf→summed feature
  3. summed feature→ThemeOf→C16
  4. summed feature→ThemeOf→C18
148 30984126 3126 Furthermore, we analyzed the 16S rDNA gene polymorphisms (SNPs) of the same dominant species (Lactobacillus plantarum and Lactobacillus fermentum) in two fermented environments, which showed that most of the mutations occurred in fermented vegetables and that fermenting environment might be the major factor for these mutations.
  1. mutations→ThemeOf→16S rDNA
  2. 16S rDNA→ThemeOf→mutations
149 30984126 3146 We identified the dominant bacterial genera in samples (Figure 3), which included Lactobacillus, Pediococcus, Weissella, Bacillus, Lactococcus, Pseudomonas, Acinetobacter, Rummeliibacillus, Enterobacter, Enterococcus and Sphingomonas.
  1. Weissella→ThemeOf→Sphingomonas
  2. Pediococcus→ThemeOf→Sphingomonas
  3. Pseudomonas→ThemeOf→Pediococcus
  4. Weissella→ThemeOf→Pediococcus
  5. Pediococcus→ThemeOf→Weissella
  6. Lactobacillus→ThemeOf→Weissella
  7. Lactococcus→ThemeOf→Weissella
  8. Weissella→ThemeOf→Lactobacillus
  9. Pediococcus→ThemeOf→Lactobacillus
  10. Lactobacillus→ThemeOf→Pediococcus
  11. Lactococcus→ThemeOf→Pediococcus
  12. Weissella→ThemeOf→Enterobacter
  13. Pediococcus→ThemeOf→Enterobacter
  14. Enterobacter→ThemeOf→Weissella
  15. Rummeliibacillus→ThemeOf→Weissella
  16. Weissella→ThemeOf→Bacillus
  17. Pediococcus→ThemeOf→Bacillus
  18. Enterobacter→ThemeOf→Pediococcus
  19. Rummeliibacillus→ThemeOf→Pediococcus
  20. Weissella→ThemeOf→Acinetobacter
  21. Pediococcus→ThemeOf→Acinetobacter
  22. Bacillus→ThemeOf→Weissella
  23. Enterococcus→ThemeOf→Weissella
  24. Weissella→ThemeOf→Pseudomonas
  25. Pediococcus→ThemeOf→Pseudomonas
  26. Bacillus→ThemeOf→Pediococcus
  27. Enterococcus→ThemeOf→Pediococcus
  28. Weissella→ThemeOf→Lactococcus
  29. Pediococcus→ThemeOf→Lactococcus
  30. Acinetobacter→ThemeOf→Weissella
  31. Sphingomonas→ThemeOf→Weissella
  32. Weissella→ThemeOf→Rummeliibacillus
  33. Pediococcus→ThemeOf→Rummeliibacillus
  34. Acinetobacter→ThemeOf→Pediococcus
  35. Sphingomonas→ThemeOf→Pediococcus
  36. Weissella→ThemeOf→Enterococcus
  37. Pediococcus→ThemeOf→Enterococcus
  38. Pseudomonas→ThemeOf→Weissella
150 30984126 3169 We analyzed the SNPs of Lactobacillus plantarum and Lactobacillus fermentum and found that most of the mutations occurred in fermented vegetables.
  1. mutations→CauseOf→occurred
151 31481601 3310 Within a species, an innovative mutation is able to purge diversity through a vertical sweep, but this process cannot occur between different species.
  1. purge diversity→ThemeOf→mutation
  2. purge diversity→ThemeOf→nov
  3. mutation→ThemeOf→purge diversity
  4. mutation→ThemeOf→nov
  5. nov→ThemeOf→purge diversity
  6. nov→ThemeOf→mutation
152 31481601 3326 However, the publication that introduced the species L. amylotrophicus clearly shows that strain DSM 20534 is relatively distant from strain DSM 20533 based on a comparison of pheS and rpoA gene sequences.
  1. DSM 20534→CauseOf→distant
153 31528033 3190 LAB are also called lantibiotics because they contain modified post-translational amino acids, such as lanthionine (two alanines linked by sulfur), beta-methyl-lanthionine, dehydroalanine, and dehydrobutyrine, which are short peptides (19-13 amino acids) and are active in Gram-positive bacteria.
  1. Gram-positive bacteria→CauseOf→lanthionine
  2. lanthionine→CauseOf→Gram-positive bacteria
  3. lanthionine→CauseOf→active
  4. dehydrobutyrine→CauseOf→active
  5. dehydroalanine→CauseOf→active
154 31936280 3698 The majority of animal-derived strains could poorly utilize lactose, sucrose, raffinose, and FOS, except for FYNLJ31L4.
  1. raffinose→ThemeOf→FYNLJ31L4
  2. raffinose→ThemeOf→FOS
  3. FYNLJ31L4→ThemeOf→raffinose
  4. FYNLJ31L4→ThemeOf→FOS
  5. FOS→ThemeOf→raffinose
  6. FOS→ThemeOf→FYNLJ31L4
155 31936280 3699 Among the 81 strains, only FYNLJ31L4 exhibited the ability to utilize D-ribose, D-xylose and sodium gluconate, while it cannot take advantage of other sugars such as cellobiose, D fructose, and D mannose that are utilized by remaining 80 L. ruminis strains.
  1. FYNLJ31L4→ThemeOf→D-ribose
  2. FYNLJ31L4→ThemeOf→sodium gluconate
  3. sodium gluconate→ThemeOf→D-ribose
  4. sodium gluconate→ThemeOf→FYNLJ31L4
  5. D-ribose→ThemeOf→FYNLJ31L4
  6. D-ribose→ThemeOf→sodium gluconate
156 31936280 3713 Insertion of the transposase in the raffinose operon of L. ruminis may affect its normal transcription leading to the inability to utilize raffinose (Figure 5D).
  1. Insertion→CauseOf→affect
157 31936280 3726 Only L. ruminis DPC6832 contained a subtype I-B CRISPR/Cas system.
  1. DPC6832→CauseOf→contained
158 31936280 3763 Accordingly, L. ruminis strains from human represented a broad variability in GH enzymes which would be corresponding to dietary diversity of human hosts.
  1. GH enzymes→ThemeOf→variability
  2. variability→ThemeOf→GH enzymes
159 31936280 3766 Heretofore, the well-known bacteriocin produced by L. ruminis belonged to class IIa bacteriocin, in which L. ruminis ATCC 27782 generated a Class II pediocin-like bacteriocin.
  1. bacteriocin→ThemeOf→generated
  2. bacteriocin→ThemeOf→ATCC
  3. bacteriocin→ThemeOf→generated
  4. bacteriocin→ThemeOf→ATCC
  5. bacteriocin→ThemeOf→generated
  6. ATCC→ThemeOf→bacteriocin
  7. ATCC→ThemeOf→bacteriocin
  8. ATCC→ThemeOf→bacteriocin
  9. ATCC→CauseOf→generated
  10. bacteriocin→ThemeOf→ATCC
160 32010538 3405 B. subtilis bs-30 and bs-34 also possessed high IL-22-inducing ability.
  1. bs-34→ThemeOf→IL-22-inducing
  2. bs-34→CauseOf→high
  3. bs-30→ThemeOf→IL-22-inducing
  4. bs-30→CauseOf→high
  5. IL-22-inducing→ThemeOf→bs-34
  6. IL-22-inducing→ThemeOf→bs-30
  7. IL-22-inducing→ThemeOf→high
161 32010538 3425 Because administration of IL-22 decreased TEWL and neutralization of IL-22 increased TEWL, the improvement of skin barrier function caused by B. coagulans sc-09 uptake may be attributed to IL-22.
  1. TEWL→ThemeOf→skin barrier function
  2. neutralization→CauseOf→increased
  3. increased→CauseOf→decreased
  4. TEWL→ThemeOf→neutralization
  5. neutralization→CauseOf→improvement
  6. increased→CauseOf→improvement
  7. TEWL→ThemeOf→decreased
  8. decreased→CauseOf→increased
  9. improvement→CauseOf→decreased
  10. TEWL→ThemeOf→TEWL
  11. decreased→CauseOf→improvement
  12. improvement→CauseOf→increased
  13. skin barrier function→ThemeOf→TEWL
  14. TEWL→ThemeOf→increased
  15. TEWL→ThemeOf→skin barrier function
  16. skin barrier function→ThemeOf→neutralization
  17. TEWL→ThemeOf→improvement
  18. TEWL→ThemeOf→TEWL
  19. skin barrier function→ThemeOf→decreased
  20. neutralization→ThemeOf→skin barrier function
  21. TEWL→ThemeOf→neutralization
  22. skin barrier function→ThemeOf→TEWL
  23. neutralization→ThemeOf→TEWL
  24. TEWL→ThemeOf→decreased
  25. skin barrier function→ThemeOf→increased
  26. neutralization→CauseOf→decreased
  27. TEWL→ThemeOf→increased
  28. skin barrier function→ThemeOf→improvement
  29. neutralization→ThemeOf→TEWL
  30. TEWL→ThemeOf→improvement
162 32118050 3600 At the species level, L. acidipiscis was predominant bacteria for non-myopathy birds (68.16%) (Figure 3).
  1. L. acidipiscis→ThemeOf→myopathy birds
  2. myopathy birds→ThemeOf→L. acidipiscis
163 32118050 3626 Elevated homocysteine is associated as marker for cardiovascular disease and can be atherogenic and thrombogenic.
  1. homocysteine→ThemeOf→cardiovascular disease
  2. homocysteine→ThemeOf→Elevated
  3. cardiovascular disease→ThemeOf→Elevated
  4. cardiovascular disease→ThemeOf→homocysteine
  5. Elevated→ThemeOf→cardiovascular disease
  6. Elevated→ThemeOf→homocysteine
164 32184766 3787 The monosaccharide compositional analysis indicated that crude EPS-CS5, EPS-CS9, EPS-CS18, and EPS-CS20 contain similar monosaccharide compositions with different ratios.
  1. EPS-CS20→ThemeOf→EPS-CS5
  2. EPS-CS5→ThemeOf→EPS-CS20
  3. EPS-CS5→ThemeOf→EPS-CS9
  4. EPS-CS5→ThemeOf→EPS-CS18
  5. EPS-CS9→ThemeOf→EPS-CS5
  6. EPS-CS18→ThemeOf→EPS-CS5
165 32184766 3873 For instance, a heavy metal transporter CzcA (DR994_03030) predicted in CS9 genome is responsible for the transport of heavy metal ions, and it shows 100% similarity to a gene of Streptococcus pneumoniae.
  1. heavy→ThemeOf→transport of heavy metal ions
  2. heavy→ThemeOf→DR994_03030
  3. heavy→ThemeOf→CzcA
  4. DR994_03030→ThemeOf→transport of heavy metal ions
  5. DR994_03030→ThemeOf→heavy
  6. DR994_03030→ThemeOf→CzcA
  7. CzcA→ThemeOf→transport of heavy metal ions
  8. transport of heavy metal ions→ThemeOf→heavy
  9. CzcA→ThemeOf→heavy
  10. transport of heavy metal ions→ThemeOf→DR994_03030
  11. CzcA→ThemeOf→DR994_03030
  12. transport of heavy metal ions→ThemeOf→CzcA
166 32184766 3881 Therefore, it could be suggested that CS5, CS9, CS18, and CS20 do not contain any antibiotic resistance and that they do not cause antibiotic contamination when used as a food starter.
  1. CS9→CauseOf→cause
  2. CS20→CauseOf→cause
  3. CS18→CauseOf→cause
  4. CS5→CauseOf→cause
167 32184766 3883 As can be seen from the results, S. thermophilus CS5, CS9, CS18, and CS20 are all sensitive to these 12 common antibiotics, which is consistent with the results of the genomic analysis.
  1. CS18→CauseOf→sensitive
  2. CS20→ThemeOf→CS9
  3. CS20→CauseOf→sensitive
  4. CS5→ThemeOf→CS9
  5. CS5→CauseOf→sensitive
  6. CS9→ThemeOf→CS5
  7. CS9→ThemeOf→CS18
  8. CS9→ThemeOf→sensitive
  9. CS9→ThemeOf→CS20
  10. CS18→ThemeOf→CS9
168 32184766 3900 In summary, S. thermophilus CS5, CS9, CS18, and CS20 do not contain antibiotic resistance genes, virulence factors with significant pathogenicity, or plasmids that can replicate independently.
  1. CS20→ThemeOf→CS5
  2. CS5→ThemeOf→CS20
  3. CS5→ThemeOf→CS9
  4. CS5→ThemeOf→CS18
  5. CS9→ThemeOf→CS5
  6. CS18→ThemeOf→CS5
169 32184766 3923 As CS18 and CS20 could utilize galactose, they could be used in the production of cheese in order to eliminate or reduce the adverse influences of galactose accumulation.
  1. galactose→ThemeOf→CS20
  2. CS20→CauseOf→reduce
  3. CS20→ThemeOf→galactose
  4. galactose→ThemeOf→reduce
170 32184766 3942 The eps gene clusters determining the EPS biosynthesis were found in CS5, CS9, CS18, and CS20 (Figure 7A).
  1. CS5→ThemeOf→eps
  2. CS20→ThemeOf→eps
  3. CS9→ThemeOf→eps
  4. eps→ThemeOf→CS5
  5. eps→ThemeOf→CS20
  6. eps→ThemeOf→CS9
171 32184766 3946 In addition, these eps clusters belonged to a common type and were found in some S. thermophilus strains, including ASCC1275, Sfi39, KLDS MS, MN-BM-A02, DGCC7710, C106, KLDS 3.1003, TH982, FI9186, and MTC310.
  1. ASCC1275→ThemeOf→DGCC7710
  2. Sfi39→ThemeOf→MN-BM-A02
  3. Sfi39→ThemeOf→DGCC7710
  4. MN-BM-A02→ThemeOf→ASCC1275
  5. MN-BM-A02→ThemeOf→Sfi39
  6. DGCC7710→ThemeOf→ASCC1275
  7. DGCC7710→ThemeOf→Sfi39
  8. ASCC1275→ThemeOf→MN-BM-A02
172 32184766 3953 Therefore, it was speculated that the additional eps2A-eps2B could improve the EPS production.
  1. eps2A-eps2B→ThemeOf→EPS production
  2. EPS production→ThemeOf→improve
  3. EPS production→ThemeOf→eps2A-eps2B
  4. eps2A-eps2B→CauseOf→improve
173 32184766 3956 These GTFs (DR994_01925, DR994_01930, DR994_01935, and DR994_01955) originated from Clostridium butyricum, Eubacteriaceae bacterium, Streptococcus equinus, and Lactococcus lactis, respectively.
  1. DR994_01935→ThemeOf→GTFs
  2. DR994_01930→ThemeOf→GTFs
  3. GTFs→ThemeOf→DR994_01935
  4. GTFs→ThemeOf→DR994_01930
  5. GTFs→ThemeOf→DR994_01925
  6. GTFs→ThemeOf→DR994_01955
  7. DR994_01925→ThemeOf→GTFs
  8. DR994_01955→ThemeOf→GTFs
174 32184766 3957 DR994_01925 was predicted to belong to GTF family 2 which could transfer sugar from UDP-glucose, UDP-N-acetyl-galactosamine (UDP-GalNAc), or GDP-mannose to a range of substrates.
  1. UDP-glucose→ThemeOf→UDP-N-acetyl-galactosamine
  2. UDP-N-acetyl-galactosamine→ThemeOf→GTF family 2
  3. DR994_01925→ThemeOf→GTF family 2
  4. UDP-glucose→ThemeOf→transfer
  5. UDP-N-acetyl-galactosamine→ThemeOf→transfer
  6. DR994_01925→ThemeOf→UDP-N-acetyl-galactosamine
  7. UDP-glucose→ThemeOf→sugar
  8. UDP-N-acetyl-galactosamine→ThemeOf→sugar
  9. DR994_01925→CauseOf→transfer
  10. UDP-glucose→ThemeOf→DR994_01925
  11. UDP-N-acetyl-galactosamine→ThemeOf→DR994_01925
  12. DR994_01925→ThemeOf→sugar
  13. GTF family 2→ThemeOf→UDP-glucose
  14. sugar→ThemeOf→UDP-glucose
  15. GTF family 2→ThemeOf→UDP-N-acetyl-galactosamine
  16. sugar→ThemeOf→GTF family 2
  17. GTF family 2→ThemeOf→transfer
  18. sugar→ThemeOf→UDP-N-acetyl-galactosamine
  19. GTF family 2→ThemeOf→sugar
  20. sugar→ThemeOf→transfer
  21. GTF family 2→ThemeOf→DR994_01925
  22. sugar→ThemeOf→DR994_01925
  23. UDP-glucose→ThemeOf→GTF family 2
  24. UDP-N-acetyl-galactosamine→ThemeOf→UDP-glucose
  25. DR994_01925→ThemeOf→UDP-glucose
175 32184766 3958 It was speculated that EPS-CS9 might contain rhamnose.
  1. rhamnose→ThemeOf→EPS-CS9
  2. rhamnose→ThemeOf→contain
  3. EPS-CS9→ThemeOf→rhamnose
  4. EPS-CS9→CauseOf→contain
176 32184766 3959 DR994_01955, however, was found similar to galactosyl transferase CpsE which could catalyze the addition of galactose to an oligosaccharide precursor or to a lipid intermediate.
  1. CpsE→ThemeOf→DR994_01955
  2. CpsE→ThemeOf→addition
  3. addition→ThemeOf→DR994_01955
  4. addition→ThemeOf→CpsE
  5. DR994_01955→ThemeOf→CpsE
  6. DR994_01955→ThemeOf→addition
177 32184766 3960 At the same time, a relatively rare galactofuranose transferase (DR994_01870) was found in CS9, which was detected only in S. thermophilus strains 488, DSM 20617, JIM8232, and TH1436.
  1. DR994_01870→CauseOf→found
178 32184766 3980 The monosaccharide compositions of crude EPS-CS5, EPS-CS9, EPS-CS18, and EPS-CS20 were analyzed using HPLC.
  1. monosaccharide compositions→ThemeOf→EPS-CS20
  2. EPS-CS9→ThemeOf→monosaccharide compositions
  3. EPS-CS9→ThemeOf→EPS-CS5
  4. EPS-CS5→ThemeOf→EPS-CS18
  5. EPS-CS5→ThemeOf→monosaccharide compositions
  6. EPS-CS18→ThemeOf→monosaccharide compositions
  7. EPS-CS5→ThemeOf→EPS-CS9
  8. EPS-CS18→ThemeOf→EPS-CS5
  9. EPS-CS5→ThemeOf→EPS-CS20
  10. monosaccharide compositions→ThemeOf→EPS-CS18
  11. EPS-CS20→ThemeOf→monosaccharide compositions
  12. monosaccharide compositions→ThemeOf→EPS-CS9
  13. EPS-CS20→ThemeOf→EPS-CS5
  14. monosaccharide compositions→ThemeOf→EPS-CS5
179 32184766 3999 In terms of bile salt tolerance, CS18 was also the most resistant to bile salt, with a survival rate of 94.40%, while CS5 had the weakest bile salt resistance, with a survival rate as low as 53.17% after incubation with 0.3% bile salt.
  1. CS18→CauseOf→resistant
180 32184766 4004 Among all the strains investigated in this study apart from CS5, CS9, CS18, and CS20 strains, only seven strains (Supplementary Table S1) were found to contain gadB gene, including B59671, APC151, GABA, KLDS_3.1003, TH1435, ND03, and ACA-DC 2.
  1. B59671→ThemeOf→gadB
  2. gadB→ThemeOf→B59671
181 32184766 4020 In addition, the results showed that the pHin value of CS9 cells with the supplement of 1% MSG was significantly higher than in M17 liquid medium (pH 2.5) (Figure 10D).
  1. MSG→CauseOf→higher
182 32184766 4038 The datasets generated for this study can be found in the nucleotide sequences of CS5, CS9, CS18 and CS20 genomes were submitted to GenBank and assigned accession numbers CP028896, CP030927, CP030928, and CP030250.
  1. CP030927→ThemeOf→CS5
  2. CP028896→ThemeOf→CS5
  3. CS5→ThemeOf→CP030927
  4. CS5→ThemeOf→CP028896
  5. CS5→ThemeOf→CP030928
  6. CS5→ThemeOf→CP030250
  7. CP030928→ThemeOf→CS5
  8. CP030250→ThemeOf→CS5
183 32226414 4048 The microflora in raw camel milk consists of Streptococcus, Lactococcus, Weissella, Pediococcus, Lactobacillus, and Enterococcus.
  1. Lactococcus→ThemeOf→Weissella
  2. Lactobacillus→ThemeOf→Weissella
  3. Weissella→ThemeOf→Streptococcus
  4. Enterococcus→ThemeOf→Weissella
  5. Weissella→ThemeOf→Lactococcus
  6. Weissella→ThemeOf→Enterococcus
  7. Weissella→ThemeOf→Lactobacillus
  8. Weissella→ThemeOf→Pediococcus
  9. Streptococcus→ThemeOf→Weissella
  10. Pediococcus→ThemeOf→Weissella
184 32226414 4138 Among them, phenylethyl alcohol and 5-decanolide were the most abundant compounds in StC with a high correlation coefficient (mainly up to 0.80).
  1. StC→ThemeOf→phenylethyl
  2. phenylethyl→ThemeOf→StC
185 32226414 4165 The sequencing data can be found in NCBI under the following accession numbers: MN966848, MN966849, MN966850, and MN966851.
  1. MN966849→ThemeOf→NCBI
  2. MN966848→ThemeOf→NCBI
  3. NCBI→ThemeOf→MN966849
  4. NCBI→ThemeOf→MN966848
  5. NCBI→ThemeOf→MN966851
  6. NCBI→ThemeOf→MN966850
  7. MN966851→ThemeOf→NCBI
  8. MN966850→ThemeOf→NCBI
186 32295530 4347 In particular, L. acidophilus, L. casei, L. rhamnosus, L. plantarum, and L. paracasei are often used in probiotic products in combination with other Lactobacillus species.
  1. L. paracasei→CauseOf→used
187 32591517 4462 Recent advances in metagenomics have revealed that alterations in the human gut microbiota are implicated in a number of disorders, such as obesity, inflammatory bowel disease, colorectal cancer, and diabetes.
  1. diabetes→ThemeOf→obesity
  2. obesity→ThemeOf→gut microbiota
  3. colorectal cancer→ThemeOf→disorders
  4. gut microbiota→ThemeOf→colorectal cancer
  5. alterations→CauseOf→implicated in
  6. diabetes→ThemeOf→colorectal cancer
  7. obesity→ThemeOf→alterations
  8. inflammatory bowel disease→ThemeOf→diabetes
  9. gut microbiota→ThemeOf→inflammatory bowel disease
  10. alterations→ThemeOf→disorders
  11. diabetes→ThemeOf→inflammatory bowel disease
  12. obesity→ThemeOf→implicated in
  13. inflammatory bowel disease→ThemeOf→obesity
  14. gut microbiota→ThemeOf→alterations
  15. disorders→ThemeOf→diabetes
  16. diabetes→ThemeOf→gut microbiota
  17. obesity→ThemeOf→disorders
  18. inflammatory bowel disease→ThemeOf→colorectal cancer
  19. gut microbiota→ThemeOf→implicated in
  20. disorders→ThemeOf→obesity
  21. diabetes→ThemeOf→alterations
  22. colorectal cancer→ThemeOf→diabetes
  23. inflammatory bowel disease→ThemeOf→gut microbiota
  24. gut microbiota→ThemeOf→disorders
  25. disorders→ThemeOf→colorectal cancer
  26. diabetes→ThemeOf→implicated in
  27. colorectal cancer→ThemeOf→obesity
  28. inflammatory bowel disease→ThemeOf→alterations
  29. alterations→ThemeOf→diabetes
  30. disorders→ThemeOf→inflammatory bowel disease
  31. diabetes→ThemeOf→disorders
  32. colorectal cancer→ThemeOf→inflammatory bowel disease
  33. inflammatory bowel disease→ThemeOf→implicated in
  34. alterations→ThemeOf→obesity
  35. disorders→ThemeOf→gut microbiota
  36. obesity→ThemeOf→diabetes
  37. colorectal cancer→ThemeOf→gut microbiota
  38. inflammatory bowel disease→ThemeOf→disorders
  39. alterations→ThemeOf→colorectal cancer
  40. disorders→ThemeOf→alterations
  41. obesity→ThemeOf→colorectal cancer
  42. colorectal cancer→ThemeOf→alterations
  43. gut microbiota→ThemeOf→diabetes
  44. alterations→ThemeOf→inflammatory bowel disease
  45. disorders→ThemeOf→implicated in
  46. obesity→ThemeOf→inflammatory bowel disease
  47. colorectal cancer→ThemeOf→implicated in
  48. gut microbiota→ThemeOf→obesity
  49. alterations→ThemeOf→gut microbiota
188 32709144 4580 Industrial microbiology has been making use of microorganisms, such as naturally occurring ones, laboratory-selected mutants, or genetically modified organisms, to produce a wide variety of industrial products of human interest.
  1. mutants→CauseOf→produce
189 32709144 4583 In recent years, an increase in the frequency of application of autochthonous strains to the manufacture of table olives has been witnessed, despite the scarce scientific studies available thereon.
  1. autochthonous→CauseOf→increase
190 32709144 4588 Unfermented olives and olives by one day of fermentation were composed solely of (Enterobacteriaceae) Hafnia alvei and Methylobacterium sp; conversely, L. plantarum and L. pentosus dominated the metabolically active microbiota of Ctrl brines and olives by the end of fermentation.
  1. L. pentosus→CauseOf→dominated
  2. L. pentosus→ThemeOf→metabolically
  3. L. plantarum→CauseOf→dominated
  4. L. plantarum→ThemeOf→metabolically
  5. metabolically→ThemeOf→L. pentosus
  6. metabolically→ThemeOf→dominated
  7. metabolically→ThemeOf→L. plantarum
191 32709144 4633 Germane species found include Alkalibacterium pelagium, Alkalibacterium psychrotoleran, Halolactibacillus sp., and Marinilactibacillus psychrotolerans/piezotolerans.
  1. Halolactibacillus→ThemeOf→Alkalibacterium psychrotoleran
  2. Alkalibacterium→ThemeOf→Alkalibacterium psychrotoleran
  3. Halolactibacillus→ThemeOf→psychrotolerans/piezotolerans
  4. Alkalibacterium→ThemeOf→psychrotolerans/piezotolerans
  5. Halolactibacillus→ThemeOf→Alkalibacterium
  6. Alkalibacterium psychrotoleran→ThemeOf→Halolactibacillus
  7. Alkalibacterium psychrotoleran→ThemeOf→psychrotolerans/piezotolerans
  8. Alkalibacterium psychrotoleran→ThemeOf→Alkalibacterium
  9. psychrotolerans/piezotolerans→ThemeOf→Halolactibacillus
  10. psychrotolerans/piezotolerans→ThemeOf→Alkalibacterium psychrotoleran
  11. psychrotolerans/piezotolerans→ThemeOf→Alkalibacterium
  12. Alkalibacterium→ThemeOf→Halolactibacillus
192 32781677 4703 Particularly, during industrial experiments, C. maltaromaticum CNB06 and Lcb.
  1. Lcb→ThemeOf→CNB06
  2. CNB06→ThemeOf→Lcb
193 32781677 4729 sakei LSK04 (SA), Lcb.
  1. LSK04→ThemeOf→Lcb
  2. Lcb→ThemeOf→LSK04
194 32781677 4774 When bacterial strains were isolated and identified, Obesumbacterium proteus was the most frequent, accounting for more than 40% of isolates in both seasons; this microorganism is usually recognized as a brewery contaminant but was also found in cheese.
  1. Obesumbacterium→CauseOf→found
195 32781677 4784 In addition, in samples where a mix of Enterobacteriaceae and Pseudomonas was intentionally spiked by spraying on cheese surfaces, C. maltaromaticum CNB06 confirmed its inhibitory effect, lowering the spoiling bacteria between 2-3 Log CFU/g.
  1. C. maltaromaticum CNB06→CauseOf→lowering
  2. CNB06→CauseOf→lowering
196 32824085 4896 Furthermore, Nostocaceae was the second most common family found in samples from Magnesia, Kavala and Halkidiki, whereas Leuconostocaceae was the second abundant family detected in samples from the Fthiotida region.
  1. Nostocaceae→ThemeOf→Leuconostocaceae
  2. Leuconostocaceae→ThemeOf→Nostocaceae
197 33144553 9462 Lactobacillus delbrueckii comprises six subspecies, namely delbrueckii, lactis, bulgaricus, indicus, jakobsenii, and sunkii, all of which have historically been differentiated based on their ability to metabolize different carbohydrates.
  1. delbrueckii→CauseOf→Lactobacillus
  2. Lactobacillus→CauseOf→delbrueckii
198 33144553 9463 lactis and bulgaricus are usually associated with the manufacture of dairy products such as cheeses and yogurt.
  1. bulgaricus→CauseOf→associated
199 33233322 4994 Two sequence variants were identified in each of the four genomic segments harboring hlyC, cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB, respectively.
  1. trxA-truB-rsuA→ThemeOf→rplS-tyrS-csdB
  2. trxA-truB-rsuA→ThemeOf→hlyC
  3. rplS-tyrS-csdB→ThemeOf→hlyC
  4. rplS-tyrS-csdB→ThemeOf→trxA-truB-rsuA
  5. hlyC→ThemeOf→rplS-tyrS-csdB
  6. hlyC→ThemeOf→trxA-truB-rsuA
200 33233322 4997 This RFLP-based typing method could be a useful tool for investigating the ecology of CaPsol and the epidemiology of its associated diseases.
  1. RFLP-based→ThemeOf→CaPsol
  2. CaPsol→ThemeOf→RFLP-based
201 33233322 5021 In fact, in Europe, CaPsol tuf-type a and tuf-type b are mainly associated with nettle and bindweed, respectively.
  1. tuf-type b→ThemeOf→nettle
  2. tuf-type b→CauseOf→associated
  3. tuf-type b→ThemeOf→bindweed
  4. CaPsol tuf-type a→ThemeOf→nettle
  5. bindweed→ThemeOf→CaPsol tuf-type a
  6. CaPsol tuf-type a→CauseOf→associated
  7. CaPsol tuf-type a→ThemeOf→bindweed
  8. bindweed→ThemeOf→tuf-type b
  9. nettle→ThemeOf→CaPsol tuf-type a
  10. bindweed→ThemeOf→associated
  11. nettle→ThemeOf→tuf-type b
  12. nettle→ThemeOf→associated
202 33233322 5026 Previous studies on plants and humans indicated that a single substitution between Val and Ile or between Asp and Asn could modify receptor binding activity or enzymatic catalytic activity.
  1. enzymatic catalytic activity→ThemeOf→modify
  2. substitution→ThemeOf→enzymatic catalytic activity
  3. substitution→ThemeOf→receptor binding activity
  4. substitution→CauseOf→modify
  5. receptor binding activity→ThemeOf→enzymatic catalytic activity
  6. receptor binding activity→ThemeOf→substitution
  7. receptor binding activity→ThemeOf→modify
  8. enzymatic catalytic activity→ThemeOf→substitution
  9. enzymatic catalytic activity→ThemeOf→receptor binding activity
203 33233322 5027 Thus, key amino acid substitutions in CaPsol tufB genes could also change EF-Tu activity and/or modify interactions with its binding protein(s).
  1. modify→CauseOf→change
  2. change→CauseOf→modify
  3. substitutions→CauseOf→modify
  4. substitutions→CauseOf→change
204 33233322 5041 In silico digestion, carried out on the representative nucleotide sequences of CaPsol sequence variants of the hlyC, cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB genomic fragments, allowed generation of virtual RFLP profiles for the restriction enzymes SspI, Hpy188I, BsaHI, and HpyCH4V, respectively (Figure 4).
  1. Hpy188I→ThemeOf→SspI
  2. SspI→ThemeOf→RFLP profiles
  3. SspI→ThemeOf→Hpy188I
  4. SspI→ThemeOf→variants
  5. RFLP profiles→ThemeOf→SspI
  6. variants→ThemeOf→SspI
205 33233322 5045 In particular, the major contribution to the variability among these lineages is due to SNPs within the cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB genomic fragments.
  1. rplS-tyrS-csdB→ThemeOf→SNPs
  2. cbiQ-glyA→ThemeOf→rplS-tyrS-csdB
  3. rplS-tyrS-csdB→ThemeOf→cbiQ-glyA
  4. cbiQ-glyA→ThemeOf→variability
  5. rplS-tyrS-csdB→ThemeOf→trxA-truB-rsuA
  6. cbiQ-glyA→ThemeOf→SNPs
  7. variability→ThemeOf→rplS-tyrS-csdB
  8. cbiQ-glyA→ThemeOf→trxA-truB-rsuA
  9. variability→ThemeOf→SNPs
  10. trxA-truB-rsuA→ThemeOf→rplS-tyrS-csdB
  11. variability→ThemeOf→cbiQ-glyA
  12. trxA-truB-rsuA→ThemeOf→variability
  13. variability→ThemeOf→trxA-truB-rsuA
  14. trxA-truB-rsuA→ThemeOf→cbiQ-glyA
  15. SNPs→ThemeOf→rplS-tyrS-csdB
  16. SNPs→ThemeOf→variability
  17. rplS-tyrS-csdB→ThemeOf→variability
  18. SNPs→ThemeOf→cbiQ-glyA
206 33233322 5051 It is reasonable to hypothesize that this variability in CaPsol strains could be related to the ecological complexity of vineyards and their surroundings, including the presence of multiple insect vectors and alternative plant hosts.
  1. variability→ThemeOf→CaPsol
  2. CaPsol→ThemeOf→related
  3. CaPsol→ThemeOf→variability
  4. variability→CauseOf→related
207 33233322 5052 The RFLP-based typing method used in the present study could be considered to be a valuable tool for research on the ecology of CaPsol and the epidemiology of its associated diseases.
  1. RFLP-based→ThemeOf→CaPsol
  2. CaPsol→ThemeOf→RFLP-based
208 33233322 5066 Actual RFLP analyses were performed using the enzyme SspI on hlyC amplicons, Hpy188I on cbiQ-glyA amplicons, BsaHI on trxA-truB-rsuA amplicons, and HpyCH4V on rplS-tyrS-csdB amplicons, respectively.
  1. HpyCH4V→ThemeOf→cbiQ-glyA
  2. rplS-tyrS-csdB→ThemeOf→RFLP
  3. HpyCH4V→ThemeOf→RFLP
  4. HpyCH4V→ThemeOf→rplS-tyrS-csdB
  5. cbiQ-glyA→ThemeOf→Hpy188I
  6. RFLP→ThemeOf→cbiQ-glyA
  7. cbiQ-glyA→ThemeOf→HpyCH4V
  8. RFLP→ThemeOf→Hpy188I
  9. cbiQ-glyA→ThemeOf→RFLP
  10. RFLP→ThemeOf→HpyCH4V
  11. cbiQ-glyA→ThemeOf→rplS-tyrS-csdB
  12. RFLP→ThemeOf→rplS-tyrS-csdB
  13. Hpy188I→ThemeOf→cbiQ-glyA
  14. rplS-tyrS-csdB→ThemeOf→cbiQ-glyA
  15. Hpy188I→ThemeOf→RFLP
  16. rplS-tyrS-csdB→ThemeOf→Hpy188I
  17. Hpy188I→ThemeOf→rplS-tyrS-csdB
  18. rplS-tyrS-csdB→ThemeOf→HpyCH4V
209 33444386 5076 Additionally, other beneficial bacteria were detected including Staphylococcus nepalensis, Lactobacillus sakei, Lactobacillus pentosus, Weissella confusa, and Bifidobacterium bifidum.
  1. Weissella→ThemeOf→Lactobacillus
  2. Weissella→ThemeOf→Staphylococcus
  3. Weissella→ThemeOf→Bifidobacterium
  4. Lactobacillus→ThemeOf→Weissella
  5. Staphylococcus→ThemeOf→Weissella
  6. Bifidobacterium→ThemeOf→Weissella
210 33444386 5182 Moreover, there is some evidence that Staphylococcus (S. nepalensis and S. xylosus) are able to improve odor by affecting volatile compounds in the fish sauce.
  1. S. nepalensis→CauseOf→affecting
  2. odor→ThemeOf→volatile compounds
  3. S. nepalensis→CauseOf→improve
  4. odor→ThemeOf→affecting
  5. S. nepalensis→ThemeOf→odor
  6. odor→ThemeOf→improve
  7. volatile compounds→ThemeOf→S. nepalensis
  8. volatile compounds→ThemeOf→affecting
  9. volatile compounds→ThemeOf→improve
  10. volatile compounds→ThemeOf→odor
  11. affecting→CauseOf→improve
  12. improve→CauseOf→affecting
  13. S. nepalensis→ThemeOf→volatile compounds
  14. odor→ThemeOf→S. nepalensis
211 33444386 5189 Additionally, to our knowledge, many genera we found in this study have not been previously reported in pla-ra; these include Fusobacterium, Subdoligranulum, Ruminococcaceae_UCG-014, Erysipelotrichaceae_UCG-003 and Bifidobacterium (Fig 1 and S1 Table).
  1. Erysipelotrichaceae→ThemeOf→Fusobacterium
  2. Erysipelotrichaceae→ThemeOf→Bifidobacterium
  3. Fusobacterium→ThemeOf→Erysipelotrichaceae
  4. Fusobacterium→ThemeOf→Bifidobacterium
  5. Bifidobacterium→ThemeOf→Erysipelotrichaceae
  6. Bifidobacterium→ThemeOf→Fusobacterium
212 33548354 6695 Microbial community changes in a female rat model of Rett syndrome Rett syndrome (RTT) is an X-linked neurodevelopmental disorder that is predominantly caused by alterations of the methyl-CpG-binding protein 2 (MECP2) gene.
  1. MECP2→ThemeOf→alterations
  2. alterations→ThemeOf→MECP2
  3. X-linked neurodevelopmental disorder→ThemeOf→caused by
  4. alterations→ThemeOf→X-linked neurodevelopmental disorder
  5. X-linked neurodevelopmental disorder→ThemeOf→MECP2
  6. alterations→ThemeOf→Rett syndrome
  7. X-linked neurodevelopmental disorder→ThemeOf→Rett syndrome
  8. X-linked neurodevelopmental disorder→ThemeOf→alterations
  9. Rett syndrome→ThemeOf→caused by
  10. Rett syndrome→ThemeOf→MECP2
  11. MECP2→ThemeOf→caused by
  12. Rett syndrome→ThemeOf→X-linked neurodevelopmental disorder
  13. MECP2→ThemeOf→X-linked neurodevelopmental disorder
  14. Rett syndrome→ThemeOf→alterations
  15. MECP2→ThemeOf→Rett syndrome
  16. alterations→CauseOf→caused by
213 33548354 6698 Although the gut microbiome has been previously characterized in humans with RTT compared to healthy controls, the impact of MECP2 mutation on the composition of the gut microbiome in animal models where the host and diet can be experimentally controlled remains to be elucidated.
  1. composition of the gut microbiome→ThemeOf→mutation
  2. MECP2→ThemeOf→impact
  3. MECP2→ThemeOf→RTT
  4. RTT→ThemeOf→impact
  5. MECP2→ThemeOf→composition of the gut microbiome
  6. RTT→ThemeOf→composition of the gut microbiome
  7. MECP2→ThemeOf→mutation
  8. RTT→ThemeOf→MECP2
  9. mutation→CauseOf→impact
  10. RTT→ThemeOf→mutation
  11. mutation→ThemeOf→RTT
  12. composition of the gut microbiome→ThemeOf→impact
  13. mutation→ThemeOf→composition of the gut microbiome
  14. composition of the gut microbiome→ThemeOf→RTT
  15. mutation→ThemeOf→MECP2
  16. composition of the gut microbiome→ThemeOf→MECP2
214 33548354 6702 Greater than 95% of all cases of RTT harbor alterations in the methyl-CpG-binding protein 2 (MECP2) gene.
  1. alterations→ThemeOf→RTT
  2. MECP2→ThemeOf→alterations
  3. MECP2→ThemeOf→RTT
  4. RTT→ThemeOf→alterations
  5. RTT→ThemeOf→MECP2
  6. alterations→ThemeOf→MECP2
215 33548354 6723 Originally Wistar, WT S100b eGFP males were back crossed over 10 generations onto a Sprague Dawley background prior to crossing with Mecp2ZFN/+.
  1. Mecp2ZFN/+→ThemeOf→eGFP
  2. Mecp2ZFN/+→ThemeOf→S100b
  3. eGFP→ThemeOf→Mecp2ZFN/+
  4. S100b→ThemeOf→Mecp2ZFN/+
216 33548354 6752 However, Mecp2ZFN/+ rats begin to diverge from WT rats in beta diversity at p49, and continue to be significantly distinct through p196 (Fig.
  1. Mecp2ZFN/+→ThemeOf→beta diversity
  2. beta diversity→ThemeOf→Mecp2ZFN/+
217 33548354 6756 At p35, the gut microbiota of both Mecp2ZFN/+ and WT rats is characterized by dominance of Bacteroidetes and Firmicutes phyla, as is also apparent in the aforementioned human studies.
  1. Mecp2ZFN/+→CauseOf→dominance
218 33548354 6759 Additionally, A. muciniphila are lower in abundance in Mecp2ZFN/+ rats compared to WT (Fig.
  1. Mecp2ZFN/+→CauseOf→lower
219 33548354 6785 Rat models of RTT have previously been utilized to assess the longitudinal effects of MECP2 mutations on neural, motor, and metabolic symptoms.
  1. neural→ThemeOf→mutations
  2. MECP2→ThemeOf→neural
  3. MECP2→ThemeOf→RTT
  4. MECP2→ThemeOf→mutations
  5. RTT→ThemeOf→MECP2
  6. RTT→ThemeOf→mutations
  7. mutations→ThemeOf→neural
  8. neural→ThemeOf→MECP2
  9. mutations→ThemeOf→MECP2
  10. mutations→ThemeOf→RTT
220 33548354 6799 In the current study, we found that Mecp2ZFN/+ differed from WT rats only in beta diversity measures.
  1. Mecp2ZFN/+→ThemeOf→beta diversity measures
  2. beta diversity measures→ThemeOf→Mecp2ZFN/+
221 33548354 6806 In the current study, we observed broad taxonomy shifts in the microbiomes of Mecp2ZFN/+ rats compared to WT rats beginning at p49, persisting through p105, and re-emerging at p196.
  1. microbiomes→ThemeOf→shifts
  2. Mecp2ZFN/+→ThemeOf→taxonomy
  3. Mecp2ZFN/+→CauseOf→shifts
  4. Mecp2ZFN/+→ThemeOf→microbiomes
  5. taxonomy→ThemeOf→Mecp2ZFN/+
  6. taxonomy→ThemeOf→shifts
  7. taxonomy→ThemeOf→microbiomes
  8. microbiomes→ThemeOf→Mecp2ZFN/+
  9. microbiomes→ThemeOf→taxonomy
222 33548354 6807 Specifically, at p105, we observed significant changes in the abundance of B. ovatus, B. uniformis, L. ruminis, and A. muciniphila in Mecp2ZFN/+ rats compared to WT.
  1. A. muciniphila→ThemeOf→abundance
  2. abundance→ThemeOf→Mecp2ZFN/+
  3. B. uniformis→ThemeOf→abundance
  4. L. ruminis→ThemeOf→changes
  5. Mecp2ZFN/+→CauseOf→changes
  6. abundance→ThemeOf→B. ovatus
  7. L. ruminis→ThemeOf→A. muciniphila
  8. Mecp2ZFN/+→ThemeOf→L. ruminis
  9. abundance→ThemeOf→B. uniformis
  10. L. ruminis→ThemeOf→Mecp2ZFN/+
  11. Mecp2ZFN/+→ThemeOf→A. muciniphila
  12. B. ovatus→ThemeOf→changes
  13. L. ruminis→ThemeOf→abundance
  14. Mecp2ZFN/+→ThemeOf→abundance
  15. B. ovatus→ThemeOf→L. ruminis
  16. L. ruminis→ThemeOf→B. ovatus
  17. Mecp2ZFN/+→ThemeOf→B. ovatus
  18. B. ovatus→ThemeOf→Mecp2ZFN/+
  19. L. ruminis→ThemeOf→B. uniformis
  20. Mecp2ZFN/+→ThemeOf→B. uniformis
  21. B. ovatus→ThemeOf→abundance
  22. A. muciniphila→ThemeOf→changes
  23. abundance→ThemeOf→changes
  24. B. uniformis→ThemeOf→changes
  25. A. muciniphila→ThemeOf→L. ruminis
  26. abundance→ThemeOf→L. ruminis
  27. B. uniformis→ThemeOf→L. ruminis
  28. A. muciniphila→ThemeOf→Mecp2ZFN/+
  29. abundance→ThemeOf→A. muciniphila
  30. B. uniformis→ThemeOf→Mecp2ZFN/+
223 33562375 5258 Variations in the relative abundance of ASV0360 Lactobacillus acidipiscis (21.65%) and ASV0001 Clostridium metallolevans (11.23%) were primarily responsible for the difference in bacterial community composition in November and January.
  1. ASV0360→ThemeOf→bacterial community composition
  2. bacterial community composition→ThemeOf→relative abundance
  3. ASV0360→ThemeOf→ASV0001
  4. ASV0001→ThemeOf→ASV0360
  5. ASV0360→ThemeOf→relative abundance
  6. ASV0001→ThemeOf→Lactobacillus
  7. Lactobacillus→ThemeOf→ASV0360
  8. ASV0001→ThemeOf→bacterial community composition
  9. Lactobacillus→ThemeOf→bacterial community composition
  10. ASV0001→ThemeOf→relative abundance
  11. Lactobacillus→ThemeOf→ASV0001
  12. relative abundance→ThemeOf→ASV0360
  13. Lactobacillus→ThemeOf→relative abundance
  14. relative abundance→ThemeOf→Lactobacillus
  15. bacterial community composition→ThemeOf→ASV0360
  16. relative abundance→ThemeOf→bacterial community composition
  17. bacterial community composition→ThemeOf→Lactobacillus
  18. relative abundance→ThemeOf→ASV0001
  19. ASV0360→ThemeOf→Lactobacillus
  20. bacterial community composition→ThemeOf→ASV0001
224 33562375 5259 There were ASV0002 L. acidipiscis (12.76%) and ASV0001 Clostridium metallolevans (11.92%) between November and March, and ASV0360 L. acidipiscis (22.93%) between January and March (Table 1).
  1. Clostridium→ThemeOf→ASV0001
  2. Clostridium→ThemeOf→ASV0360 L. acidipiscis
  3. Clostridium→ThemeOf→ASV0002 L. acidipiscis
  4. ASV0360 L. acidipiscis→ThemeOf→Clostridium
  5. ASV0002 L. acidipiscis→ThemeOf→Clostridium
  6. ASV0001→ThemeOf→Clostridium
225 33562375 5264 Among the common foods, P. arundinacea, P. annua, R. japonicus, P. supina, and V. natans had an extremely significant correlation with intestinal bacteria, and P. criopolitanum and V. natans had a significant correlation with intestinal potential pathogenic bacteria (Table 2 and Table 3).
  1. P. criopolitanum→ThemeOf→intestinal bacteria
  2. intestinal bacteria→ThemeOf→P. criopolitanum
226 33670654 5392 Notably, it was previously demonstrated that, in terms of short chain fatty acid profiles, the 22% OS group had the lowest lactic acid/acetic acid in the FTMR.
  1. lactic acid/acetic acid→ThemeOf→lowest
  2. 22% OS→CauseOf→lowest
  3. 22% OS→ThemeOf→lactic acid/acetic acid
  4. lactic acid/acetic acid→ThemeOf→22% OS
227 33679767 5406 Changes in the composition and structure of the gastrointestinal flora can affect the characteristics and development of the host immune system and even induce a series of central nervous system inflammation events.
  1. composition→ThemeOf→inflammation
  2. Changes→ThemeOf→composition
  3. inflammation→ThemeOf→induce
  4. characteristics→ThemeOf→composition
  5. composition→ThemeOf→induce
  6. Changes→CauseOf→affect
  7. characteristics→ThemeOf→Changes
  8. composition→ThemeOf→characteristics
  9. affect→CauseOf→induce
  10. characteristics→ThemeOf→affect
  11. composition→ThemeOf→development of the host immune system
  12. inflammation→ThemeOf→composition
  13. composition→ThemeOf→Changes
  14. inflammation→ThemeOf→Changes
  15. development of the host immune system→ThemeOf→induce
  16. composition→ThemeOf→affect
  17. inflammation→ThemeOf→affect
  18. Changes→ThemeOf→inflammation
  19. induce→CauseOf→affect
  20. development of the host immune system→ThemeOf→composition
  21. Changes→CauseOf→induce
  22. development of the host immune system→ThemeOf→Changes
  23. Changes→ThemeOf→characteristics
  24. characteristics→ThemeOf→induce
  25. development of the host immune system→ThemeOf→affect
  26. Changes→ThemeOf→development of the host immune system
228 33679767 5412 Moreover, including L. acidipiscis enhanced the development of Vgamma1+gammadelta T cells but suppressed that of Vgamma4+gammadelta T cells.
  1. enhanced→CauseOf→suppressed
  2. suppressed→CauseOf→enhanced
  3. L. acidipiscis→CauseOf→enhanced
  4. L. acidipiscis→CauseOf→suppressed
229 33679767 5413 In summary, our results demonstrated the ability of L. acidipiscis to induce generation of regulatory gammadelta T cells that suppress the development of the encephalomyelitic Th1 and Th17 cells and the progress of EAE.
  1. L. acidipiscis→CauseOf→suppress
230 33679767 5418 This model is consistent with the induction method of MS, specifically combining myelin oligodendrocyte glycoprotein residues 35-55 (MOG35-55) with immunostimulant to induce the generation of pathogenic Th1 and Th17 cells.
  1. MOG35-55→CauseOf→induce
  2. myelin oligodendrocyte glycoprotein→ThemeOf→induce
  3. myelin oligodendrocyte glycoprotein→ThemeOf→MOG35-55
  4. MOG35-55→ThemeOf→myelin oligodendrocyte glycoprotein
231 33679767 5425 In the intestinal epithelial lymphocytes (IELs) of mice, specifically in the duodenum and jejunum, the percentage of T cells consisting of gammadelta T cells was observed to be as high as 70%, much higher than that of alphabeta T cells.
  1. gammadelta T cells→CauseOf→higher
232 33679767 5431 According to the composition of T cell receptors, the peripheral gammadelta T cells in mice can be divided into two main subsets: Vgamma1+ and Vgamma4+.
  1. Vgamma4+→ThemeOf→gammadelta
  2. Vgamma1+→ThemeOf→gammadelta
  3. gammadelta→ThemeOf→Vgamma4+
  4. gammadelta→ThemeOf→Vgamma1+
233 33679767 5432 However, Vgamma1+ gammadelta T cells have been shown to produce more Th2-type cytokines such as IL-4, while Vgamma4+ gammadelta T cells have been shown to preferentially produce IL-17A.
  1. Vgamma4+ gammadelta T→ThemeOf→IL-4
  2. Vgamma1+ gammadelta T cells→CauseOf→more
  3. Vgamma4+ gammadelta T→ThemeOf→IL-17A
  4. Vgamma1+ gammadelta T cells→ThemeOf→Th2-type cytokines
  5. Vgamma4+ gammadelta T→CauseOf→more
  6. Th2-type cytokines→ThemeOf→IL-4
  7. Vgamma4+ gammadelta T→ThemeOf→Th2-type cytokines
  8. Th2-type cytokines→ThemeOf→Vgamma4+ gammadelta T
  9. IL-17A→ThemeOf→Vgamma4+ gammadelta T
  10. Th2-type cytokines→ThemeOf→IL-17A
  11. IL-17A→ThemeOf→more
  12. Th2-type cytokines→ThemeOf→more
  13. IL-4→ThemeOf→Vgamma4+ gammadelta T
  14. IL-17A→ThemeOf→Vgamma1+ gammadelta T cells
  15. Th2-type cytokines→ThemeOf→Vgamma1+ gammadelta T cells
  16. IL-4→ThemeOf→more
  17. IL-17A→ThemeOf→Th2-type cytokines
  18. IL-4→ThemeOf→Vgamma1+ gammadelta T cells
  19. Vgamma1+ gammadelta T cells→ThemeOf→IL-4
  20. IL-4→ThemeOf→Th2-type cytokines
  21. Vgamma1+ gammadelta T cells→ThemeOf→IL-17A
234 33679767 5435 In rodent models, discrepancies in gut microbiota were found to be associated with in some cases susceptibility to EAE and other cases resistance to EAE.
  1. EAE→ThemeOf→gut
  2. gut→ThemeOf→EAE
  3. discrepancies→CauseOf→associated
  4. gut→ThemeOf→discrepancies
  5. discrepancies→ThemeOf→EAE
  6. gut→ThemeOf→susceptibility
  7. discrepancies→ThemeOf→susceptibility
  8. discrepancies→ThemeOf→gut
  9. susceptibility→ThemeOf→associated
  10. susceptibility→ThemeOf→EAE
  11. EAE→ThemeOf→associated
  12. susceptibility→ThemeOf→discrepancies
  13. EAE→ThemeOf→discrepancies
  14. susceptibility→ThemeOf→gut
  15. EAE→ThemeOf→susceptibility
  16. gut→ThemeOf→associated
235 33679767 5436 Previous studies from our laboratory showed that CD44 may also regulate inflammation, in as much as CD44 deficiency inhibits proinflammatory Th1 and Th17 cells while promoting CD4+ Th2 and Treg cell differentiation.
  1. inhibits→CauseOf→regulate
  2. deficiency→CauseOf→promoting
  3. deficiency→CauseOf→regulate
  4. promoting→CauseOf→inhibits
  5. regulate→CauseOf→inhibits
  6. promoting→CauseOf→regulate
  7. deficiency→CauseOf→inhibits
  8. regulate→CauseOf→promoting
  9. inhibits→CauseOf→promoting
236 33679767 5437 In fact, CD44 deficiency led to decreased inflammation and amelioration of an experimental form of EAE.
  1. CD44→ThemeOf→decreased
  2. deficiency→CauseOf→amelioration
  3. CD44→ThemeOf→amelioration
  4. CD44→ThemeOf→deficiency
  5. amelioration→CauseOf→decreased
  6. deficiency→CauseOf→decreased
  7. deficiency→ThemeOf→CD44
  8. decreased→CauseOf→amelioration
237 33679767 5442 In the absence of these regulatory gammadelta T cells, L. acidipiscis did not protect mice from EAE.
  1. L. acidipiscis→CauseOf→not
238 33679767 5470 These encephalitogenic CD4+ T cells were cultured in RPMI1640 medium (Gibco BRL) with 10% FCS and MOG35-55 (30 mug/mL).
  1. MOG35-55→ThemeOf→CD4
  2. encephalitogenic→ThemeOf→CD4
  3. encephalitogenic→ThemeOf→MOG35-55
  4. CD4→ThemeOf→encephalitogenic
  5. CD4→ThemeOf→MOG35-55
  6. MOG35-55→ThemeOf→encephalitogenic
239 33679767 5498 The amounts of acetic acid (p < 0.01), n-butyric acid (p < 0.01), i-butyric acid (p < 0.001), propionic acid (p < 0.001), i-valeric acid (p < 0.01) and n-caproic acid (p < 0.05) in the feces of C57BL/6 mice fed with L. acidipiscis were significantly higher than for those fed with E. coli.
  1. n-caproic acid→ThemeOf→higher
  2. i-butyric acid→ThemeOf→n-butyric acid
  3. propionic acid→ThemeOf→n-caproic acid
  4. n-butyric acid→ThemeOf→i-valeric acid
  5. L. acidipiscis→ThemeOf→n-caproic acid
  6. n-caproic acid→ThemeOf→i-valeric acid
  7. i-butyric acid→ThemeOf→amounts of acetic acid
  8. propionic acid→ThemeOf→i-butyric acid
  9. n-butyric acid→ThemeOf→propionic acid
  10. L. acidipiscis→ThemeOf→i-butyric acid
  11. n-caproic acid→ThemeOf→propionic acid
  12. i-valeric acid→ThemeOf→L. acidipiscis
  13. propionic acid→ThemeOf→higher
  14. n-butyric acid→ThemeOf→amounts of acetic acid
  15. L. acidipiscis→CauseOf→higher
  16. n-caproic acid→ThemeOf→n-butyric acid
  17. i-valeric acid→ThemeOf→n-caproic acid
  18. propionic acid→ThemeOf→i-valeric acid
  19. amounts of acetic acid→ThemeOf→L. acidipiscis
  20. L. acidipiscis→ThemeOf→i-valeric acid
  21. n-caproic acid→ThemeOf→amounts of acetic acid
  22. i-valeric acid→ThemeOf→i-butyric acid
  23. propionic acid→ThemeOf→n-butyric acid
  24. amounts of acetic acid→ThemeOf→n-caproic acid
  25. L. acidipiscis→ThemeOf→propionic acid
  26. i-butyric acid→ThemeOf→L. acidipiscis
  27. i-valeric acid→ThemeOf→higher
  28. propionic acid→ThemeOf→amounts of acetic acid
  29. amounts of acetic acid→ThemeOf→i-butyric acid
  30. L. acidipiscis→ThemeOf→n-butyric acid
  31. i-butyric acid→ThemeOf→n-caproic acid
  32. i-valeric acid→ThemeOf→propionic acid
  33. n-butyric acid→ThemeOf→L. acidipiscis
  34. amounts of acetic acid→ThemeOf→higher
  35. L. acidipiscis→ThemeOf→amounts of acetic acid
  36. i-butyric acid→ThemeOf→higher
  37. i-valeric acid→ThemeOf→n-butyric acid
  38. n-butyric acid→ThemeOf→n-caproic acid
  39. amounts of acetic acid→ThemeOf→i-valeric acid
  40. n-caproic acid→ThemeOf→L. acidipiscis
  41. i-butyric acid→ThemeOf→i-valeric acid
  42. i-valeric acid→ThemeOf→amounts of acetic acid
  43. n-butyric acid→ThemeOf→i-butyric acid
  44. amounts of acetic acid→ThemeOf→propionic acid
  45. n-caproic acid→ThemeOf→i-butyric acid
  46. i-butyric acid→ThemeOf→propionic acid
  47. propionic acid→ThemeOf→L. acidipiscis
  48. n-butyric acid→ThemeOf→higher
  49. amounts of acetic acid→ThemeOf→n-butyric acid
240 33679767 5499 Furthermore, the data showed a significant difference (p < 0.001) in the concentration of n-valeric acid between the EAE-WT mice that received E. coli and those receiving L. acidipiscis, indicating that L. acidipiscis could induce protective immunophenotypes by synthesizing acetic acid and other SFCAs in the intestinal tracts of EAE-susceptible mice.
  1. L. acidipiscis→CauseOf→induce
  2. L. acidipiscis→CauseOf→acetic acid
  3. acetic acid→ThemeOf→induce
  4. acetic acid→CauseOf→L. acidipiscis
241 33679767 5504 The production of protective IL-10 and that of IL-13 were each increased, while the production of pathological IFN-gamma and that of IL-17A were each significantly decreased, indicating that L. acidipiscis may regulate the differentiation of cerebrospinal inflammatory CD4+ T cells and induce a deviation of the protective T cell immune response (Figure 4).
  1. induce→CauseOf→deviation
  2. induce→CauseOf→regulate
  3. L. acidipiscis→CauseOf→induce
  4. deviation→CauseOf→induce
  5. deviation→CauseOf→regulate
  6. L. acidipiscis→CauseOf→regulate
  7. regulate→CauseOf→deviation
  8. regulate→CauseOf→induce
  9. L. acidipiscis→CauseOf→deviation
242 33679767 5512 In addition, the differentiation of Th2 cells was significantly enhanced after they were co-cultured with L. acidipiscis (Figure 6B), whereas the development of Th17 cells was significantly inhibited after they were co-cultured with L. acidipiscis (Figure 6C).
  1. L. acidipiscis→CauseOf→inhibited
  2. L. acidipiscis→CauseOf→enhanced
243 33679767 5528 Our results showed that compared with E. coli, L. acidipiscis increased the production of CD4+ FOXP3+ Treg cells, IL-10 and IL-13, and inhibited the production of Th1, Th17, IFN-gamma and IL-17A.
  1. production→ThemeOf→L. acidipiscis
  2. IL-17A→ThemeOf→increased
  3. IL-10→ThemeOf→increased
  4. production of Th1→ThemeOf→L. acidipiscis
  5. L. acidipiscis→ThemeOf→CD4
  6. FOXP3→ThemeOf→production of Th1
  7. production→ThemeOf→FOXP3
  8. IL-17A→ThemeOf→L. acidipiscis
  9. IL-10→ThemeOf→L. acidipiscis
  10. production of Th1→ThemeOf→FOXP3
  11. L. acidipiscis→ThemeOf→IL-17A
  12. FOXP3→ThemeOf→inhibited
  13. production→ThemeOf→CD4
  14. CD4→ThemeOf→production
  15. IL-13→ThemeOf→production
  16. production of Th1→ThemeOf→production
  17. inhibited→CauseOf→increased
  18. L. acidipiscis→ThemeOf→IL-13
  19. FOXP3→ThemeOf→increased
  20. production→ThemeOf→IL-17A
  21. CD4→ThemeOf→production of Th1
  22. IL-13→ThemeOf→production of Th1
  23. production of Th1→ThemeOf→CD4
  24. IFN-gamma→ThemeOf→production
  25. L. acidipiscis→ThemeOf→IL-10
  26. FOXP3→ThemeOf→L. acidipiscis
  27. production→ThemeOf→IL-13
  28. CD4→ThemeOf→inhibited
  29. IL-13→ThemeOf→inhibited
  30. production of Th1→ThemeOf→IL-17A
  31. IFN-gamma→ThemeOf→production of Th1
  32. L. acidipiscis→ThemeOf→production of Th1
  33. production→ThemeOf→IL-10
  34. CD4→ThemeOf→increased
  35. IL-13→ThemeOf→increased
  36. production of Th1→ThemeOf→IL-13
  37. IFN-gamma→ThemeOf→inhibited
  38. L. acidipiscis→CauseOf→inhibited
  39. production→ThemeOf→production of Th1
  40. CD4→ThemeOf→L. acidipiscis
  41. IL-13→ThemeOf→L. acidipiscis
  42. production of Th1→ThemeOf→IL-10
  43. IFN-gamma→ThemeOf→increased
  44. L. acidipiscis→ThemeOf→IFN-gamma
  45. production→ThemeOf→inhibited
  46. IL-17A→ThemeOf→production
  47. IL-10→ThemeOf→production
  48. production of Th1→ThemeOf→inhibited
  49. IFN-gamma→ThemeOf→L. acidipiscis
  50. L. acidipiscis→CauseOf→increased
  51. production→ThemeOf→IFN-gamma
  52. IL-17A→ThemeOf→production of Th1
  53. IL-10→ThemeOf→production of Th1
  54. production of Th1→ThemeOf→IFN-gamma
  55. increased→CauseOf→inhibited
  56. L. acidipiscis→ThemeOf→FOXP3
  57. production→ThemeOf→increased
  58. IL-17A→ThemeOf→inhibited
  59. IL-10→ThemeOf→inhibited
  60. production of Th1→ThemeOf→increased
  61. L. acidipiscis→ThemeOf→production
  62. FOXP3→ThemeOf→production
244 33679767 5538 While Vgamma1+ gammadelta T cells produce more Th2-type cytokines such as IL-4 and IL-5, Vgamma4+ gammadelta T cells preferentially produce IL-17.
  1. IL-5→ThemeOf→Vgamma1+ gammadelta T
  2. IL-17→ThemeOf→Vgamma4+ gammadelta T
  3. IL-17→ThemeOf→Vgamma1+ gammadelta T
  4. Vgamma1+ gammadelta T→ThemeOf→IL-5
  5. Vgamma1+ gammadelta T→ThemeOf→IL-17
  6. Vgamma1+ gammadelta T→ThemeOf→IL-4
  7. Vgamma4+ gammadelta T→ThemeOf→IL-5
  8. IL-4→ThemeOf→Vgamma4+ gammadelta T
  9. Vgamma4+ gammadelta T→ThemeOf→IL-17
  10. IL-4→ThemeOf→Vgamma1+ gammadelta T
  11. Vgamma4+ gammadelta T→ThemeOf→IL-4
  12. IL-5→ThemeOf→Vgamma4+ gammadelta T
245 33679767 5540 In this study, we found a negative correlation between L. acidipiscis in the intestinal tract and the progress of EAE.
  1. progress→ThemeOf→L. acidipiscis
  2. EAE→ThemeOf→negative
  3. EAE→ThemeOf→progress
  4. EAE→ThemeOf→L. acidipiscis
  5. L. acidipiscis→CauseOf→negative
  6. L. acidipiscis→ThemeOf→progress
  7. L. acidipiscis→ThemeOf→EAE
  8. progress→ThemeOf→negative
  9. progress→ThemeOf→EAE
246 33679767 5541 The resistance of CD44KO mice to EAE was related to the stimulation and activation of gammadelta T cells in small intestine epithelial tissues by L. acidipiscis.
  1. gammadelta T→ThemeOf→CD44KO
  2. stimulation→CauseOf→activation
  3. gammadelta T→ThemeOf→stimulation
  4. L. acidipiscis→CauseOf→activation
  5. L. acidipiscis→ThemeOf→gammadelta T
  6. L. acidipiscis→ThemeOf→CD44KO
  7. L. acidipiscis→CauseOf→stimulation
  8. CD44KO→ThemeOf→activation
  9. activation→CauseOf→stimulation
  10. CD44KO→ThemeOf→gammadelta T
  11. gammadelta T→ThemeOf→activation
  12. CD44KO→ThemeOf→L. acidipiscis
  13. gammadelta T→ThemeOf→L. acidipiscis
  14. CD44KO→ThemeOf→stimulation
247 33679767 5545 Our results showed a negative correlation between the amount of intestinal L. acidipiscis and the progression of EAE, and showed the regulation of encephalitogenic CD4+ T cell differentiation by L. acidipiscis to be related to gammadelta T cells.
  1. CD4→ThemeOf→L. acidipiscis
  2. L. acidipiscis→ThemeOf→gammadelta T
  3. CD4→ThemeOf→gammadelta T
  4. L. acidipiscis→ThemeOf→EAE
  5. CD4→ThemeOf→EAE
  6. L. acidipiscis→ThemeOf→CD4
  7. gammadelta T→ThemeOf→L. acidipiscis
  8. gammadelta T→ThemeOf→EAE
  9. gammadelta T→ThemeOf→CD4
  10. EAE→ThemeOf→L. acidipiscis
  11. EAE→ThemeOf→gammadelta T
  12. EAE→ThemeOf→CD4
248 33679767 5546 Meanwhile in our experiments, L. acidipiscis suppressed in vitro the proliferation of Th1 and Th17 cells as well as the secretion of IFN-gamma and IL-17A, and clearly promoted the development of Treg and Th2 cells.
  1. L. acidipiscis→CauseOf→suppressed
  2. promoted→CauseOf→suppressed
  3. suppressed→CauseOf→promoted
  4. L. acidipiscis→CauseOf→promoted
249 34045460 5555 The GM byproduct trimethylamine-n-oxide could degrade some circRNAs.
  1. trimethylamine-n-oxide→CauseOf→degrade
250 34045460 5639 After blockade with 5% nonfat dry milk in Tris-buffered saline (20 mM Tris-HCl, 500 mM NaCl, pH 7.4) with 0.2% Tween-20 (T104863; Aladdin, Beijing, China), the PVDF membranes were probed with antibodies overnight at 4 C, followed by incubation with a horseradish peroxidase-conjugated goat anti-mouse (G2211-1-A; Servicebio, Beijing, China) or goat anti-rabbit (G2210-2-A; Servicebio) IgG secondary antibody (1:2000 dilution).
  1. G2211-1-A→ThemeOf→dry milk
  2. dry milk→ThemeOf→G2211-1-A
  3. dry milk→ThemeOf→G2210-2-A
  4. G2210-2-A→ThemeOf→dry milk
251 34045460 5641 The bodyweights of mice fed a HSHF diet were higher than those fed a standard diet (control, p < 0.05) (Fig.
  1. bodyweights→ThemeOf→HSHF
  2. bodyweights→ThemeOf→higher
  3. HSHF→ThemeOf→bodyweights
  4. HSHF→CauseOf→higher
252 34045460 5645 These data suggested that the HSHF diet utilized caused increases in bodyweight, blood glucose level, and TMAO level.
  1. HSHF→CauseOf→increases
253 34045460 5646 Sequencing of the 16 S rRNA gene showed that the HSHF diet significantly decreased the operational taxonomic units (OTUs) of bacteria of the phyla Acidobacteria, Verrucomicrobia, Tenericutes, and Firmicutes, while increasing the OTUs of bacteria of the phyla Bacteroidetes, Proteobacteria, Deferribacteres, Cyanobacteria and Actinobacteria (p < 0.05) (Fig.
  1. HSHF→CauseOf→decreased
  2. decreased→CauseOf→increasing
  3. increasing→CauseOf→decreased
  4. HSHF→CauseOf→increasing
254 34045460 5650 Hence, the HSHF diet could induce dysbacteriosis in mice.
  1. HSHF→ThemeOf→dysbacteriosis
  2. HSHF→CauseOf→induce
  3. dysbacteriosis→ThemeOf→HSHF
  4. dysbacteriosis→ThemeOf→induce
255 34045460 5653 The pathology of the small intestine and colon of mice fed the HSHF diet was different from that of mice fed the standard diet.
  1. colon→ThemeOf→different
  2. HSHF→CauseOf→different
256 34045460 5661 S2F) tissues showed that the HSHF diet not only induced dysbacteriosis, but also activated inflammation and damage to multiple organs.
  1. HSHF→CauseOf→activated
  2. HSHF→CauseOf→induced
  3. activated→CauseOf→induced
  4. induced→CauseOf→activated
257 34045460 5676 These data demonstrated that atrophy, inflammation, or the immune response were imbalanced in the brains of mice with HSHF diet-induced dysbacteriosis.
  1. atrophy→ThemeOf→immune response
  2. HSHF→ThemeOf→dysbacteriosis
  3. dysbacteriosis→ThemeOf→atrophy
  4. HSHF→ThemeOf→inflammation
  5. dysbacteriosis→ThemeOf→inflammation
  6. HSHF→ThemeOf→immune response
  7. dysbacteriosis→ThemeOf→HSHF
  8. immune response→ThemeOf→atrophy
  9. dysbacteriosis→ThemeOf→immune response
  10. immune response→ThemeOf→dysbacteriosis
  11. inflammation→ThemeOf→atrophy
  12. immune response→ThemeOf→inflammation
  13. inflammation→ThemeOf→dysbacteriosis
  14. immune response→ThemeOf→HSHF
  15. atrophy→ThemeOf→dysbacteriosis
  16. inflammation→ThemeOf→HSHF
  17. atrophy→ThemeOf→inflammation
  18. inflammation→ThemeOf→immune response
  19. atrophy→ThemeOf→HSHF
  20. HSHF→ThemeOf→atrophy
258 34045460 5701 The ACh level in brain tissues was important for the interactions between the brain circRNA of chr5_21278044/21281602_+, chrX_162934286/162941844_+ and chr16_37121798/ 37129964_-, and bacteria from Paraprevotella, Helicobacteraceae, Erysipelotrichaceae, [Ruminococcus] and Streptophyta (Fig.
  1. chr5_21278044/21281602_+→ThemeOf→Erysipelotrichaceae
  2. chr5_21278044/21281602_+→ThemeOf→ACh
  3. chrX_162934286/162941844_+→ThemeOf→Erysipelotrichaceae
  4. chrX_162934286/162941844_+→ThemeOf→ACh
  5. ACh→ThemeOf→Erysipelotrichaceae
  6. ACh→ThemeOf→chr5_21278044/21281602_+
  7. ACh→ThemeOf→chrX_162934286/162941844_+
  8. Erysipelotrichaceae→ThemeOf→chr5_21278044/21281602_+
  9. Erysipelotrichaceae→ThemeOf→chrX_162934286/162941844_+
  10. Erysipelotrichaceae→ThemeOf→ACh
259 34045460 5719 Levels of some monoamine neurotransmitter were changed in mice fed the HSHF diet (Figs.
  1. HSHF→CauseOf→changed
260 34045460 5741 8Ad), which indicated that energy metabolism was imbalanced due to dysfunction of NADH dehydrogenase activity and oxidoreductase.
  1. dysfunction→ThemeOf→NADH
  2. dysfunction→ThemeOf→energy metabolism
  3. energy metabolism→ThemeOf→NADH
  4. energy metabolism→ThemeOf→dysfunction
  5. NADH→ThemeOf→dysfunction
  6. NADH→ThemeOf→energy metabolism
261 34045460 5744 In agreement with results from other studies, TMA resulted in negative consequences for the host and, in the present study, TMA led to negative consequences for the nervous system.
  1. TMA→CauseOf→negative
  2. TMA→CauseOf→negative
262 34045460 5752 Previously, using in an overexpressed circNF1-419 adeno-associated virus system, we showed that circRNAs in the brain influenced the cholinergic system of the brain, and changed the GM composition, intestinal homeostasis/physiology, and even the GM trajectory in newborn mice.
  1. GM composition→ThemeOf→circRNAs
  2. GM trajectory→ThemeOf→intestinal homeostasis/physiology
  3. cholinergic system→ThemeOf→changed
  4. GM composition→ThemeOf→changed
  5. GM trajectory→ThemeOf→influenced
  6. circRNAs→ThemeOf→GM composition
  7. intestinal homeostasis/physiology→ThemeOf→GM composition
  8. GM trajectory→ThemeOf→cholinergic system
  9. circRNAs→ThemeOf→intestinal homeostasis/physiology
  10. intestinal homeostasis/physiology→ThemeOf→influenced
  11. GM trajectory→ThemeOf→circRNAs
  12. circRNAs→CauseOf→influenced
  13. intestinal homeostasis/physiology→ThemeOf→GM trajectory
  14. GM trajectory→ThemeOf→changed
  15. circRNAs→ThemeOf→GM trajectory
  16. intestinal homeostasis/physiology→ThemeOf→cholinergic system
  17. cholinergic system→ThemeOf→GM composition
  18. circRNAs→ThemeOf→cholinergic system
  19. GM composition→ThemeOf→intestinal homeostasis/physiology
  20. intestinal homeostasis/physiology→ThemeOf→circRNAs
  21. cholinergic system→ThemeOf→intestinal homeostasis/physiology
  22. circRNAs→CauseOf→changed
  23. GM composition→ThemeOf→influenced
  24. intestinal homeostasis/physiology→ThemeOf→changed
  25. cholinergic system→ThemeOf→influenced
  26. changed→CauseOf→influenced
  27. GM composition→ThemeOf→GM trajectory
  28. influenced→CauseOf→changed
  29. cholinergic system→ThemeOf→GM trajectory
  30. GM composition→ThemeOf→cholinergic system
  31. GM trajectory→ThemeOf→GM composition
  32. cholinergic system→ThemeOf→circRNAs
263 34045460 5764 Methanogens described in the human microbiota include Euryarchaeota (including M. smithii, M. oralis, M. arbophilus, M. massiliensis, M. luminyensis, M. stadtmanae, Ca.
  1. Euryarchaeota→ThemeOf→M. luminyensis
  2. M. luminyensis→ThemeOf→Euryarchaeota
  3. M. massiliensis→ThemeOf→Euryarchaeota
  4. Euryarchaeota→ThemeOf→M. massiliensis
264 34045460 5769 One clinical investigation showed that a negative association between methane concentrations in breath and anthropometric biomarkers of obesity, and that methane significantly decreased the neurological deficit induced by cerebral ischemia and reperfusion via the antioxidant pathway of PI3K/Akt/HO-1.
  1. methane→CauseOf→breath
  2. breath→ThemeOf→cerebral ischemia
  3. neurological deficit→ThemeOf→decreased
  4. methane→CauseOf→decreased
  5. breath→CauseOf→methane
  6. neurological deficit→ThemeOf→HO-1
  7. cerebral ischemia→CauseOf→methane
  8. methane→CauseOf→neurological deficit
  9. breath→ThemeOf→obesity
  10. HO-1→ThemeOf→cerebral ischemia
  11. cerebral ischemia→ThemeOf→obesity
  12. methane→ThemeOf→HO-1
  13. breath→ThemeOf→decreased
  14. HO-1→ThemeOf→methane
  15. cerebral ischemia→ThemeOf→breath
  16. obesity→ThemeOf→cerebral ischemia
  17. breath→ThemeOf→neurological deficit
  18. HO-1→ThemeOf→obesity
  19. cerebral ischemia→ThemeOf→decreased
  20. obesity→CauseOf→methane
  21. breath→ThemeOf→HO-1
  22. HO-1→ThemeOf→breath
  23. cerebral ischemia→ThemeOf→neurological deficit
  24. obesity→ThemeOf→breath
  25. neurological deficit→ThemeOf→cerebral ischemia
  26. HO-1→ThemeOf→decreased
  27. cerebral ischemia→ThemeOf→HO-1
  28. obesity→ThemeOf→decreased
  29. neurological deficit→CauseOf→methane
  30. HO-1→ThemeOf→neurological deficit
  31. methane→CauseOf→cerebral ischemia
  32. obesity→ThemeOf→neurological deficit
  33. neurological deficit→ThemeOf→obesity
  34. methane→CauseOf→obesity
  35. obesity→ThemeOf→HO-1
  36. neurological deficit→ThemeOf→breath
265 34045460 5785 Neuronal ACh and non-neuronal ACh have been demonstrated to modulate the inflammatory response: ACh protects against C. albicans infection by inhibiting biofilm formation and promoting hemocyte function in a model of Galleria mellonella infection.
  1. ACh→CauseOf→promoting
  2. protects→CauseOf→inhibiting
  3. inhibiting→CauseOf→protects
  4. protects→CauseOf→promoting
  5. inhibiting→CauseOf→promoting
  6. promoting→CauseOf→protects
  7. promoting→CauseOf→inhibiting
  8. Galleria mellonella infection→CauseOf→ACh
  9. hemocyte function→CauseOf→ACh
  10. ACh→CauseOf→biofilm
  11. ACh→CauseOf→Galleria mellonella infection
  12. biofilm→CauseOf→ACh
  13. ACh→CauseOf→protects
  14. ACh→CauseOf→hemocyte function
  15. ACh→CauseOf→inhibiting
266 34045460 5800 Furthermore, expression of retinoic acid-inducible gene I supported the notion that too much of a HSHF diet affects immunity and increases the risk of virus invasion (p < 0.05) (Fig.
  1. affects→CauseOf→increases
  2. increases→CauseOf→affects
  3. retinoic acid-inducible gene I→ThemeOf→increases
  4. too→CauseOf→increases
  5. retinoic acid-inducible gene I→ThemeOf→too
  6. too→CauseOf→affects
  7. retinoic acid-inducible gene I→ThemeOf→affects
  8. too→ThemeOf→retinoic acid-inducible gene I
267 34045460 5812 S5), including Butyrivibrio hungatei, Anaerostipes hadrus, Butyrivibrio proteoclasticus, Blautia sp.
  1. Butyrivibrio proteoclasticus→ThemeOf→Blautia
  2. Anaerostipes→ThemeOf→Blautia
  3. Butyrivibrio→CauseOf→Blautia
  4. Blautia→CauseOf→Butyrivibrio
  5. Blautia→ThemeOf→Butyrivibrio proteoclasticus
  6. Blautia→ThemeOf→Anaerostipes
268 34074340 5879 Because alleles at lower frequencies are less informative for association analysis, we retained only SNPs with minor allele frequencies (MAFs) above 5% and kept only SNPs that occurred in more than 95% of individuals.
  1. MAF→CauseOf→SNPs
  2. SNPs→CauseOf→MAF
269 34074340 5893 The covariates included the top five host genetic principal components and first three principal components of significant and suggestive significant SNPs associated with RFI.
  1. SNPs→ThemeOf→RFI
  2. RFI→ThemeOf→SNPs
270 34074340 5907 The most significant SNP controlling the relative abundance of Parabacteroides was rs10730843 (Fig.
  1. Parabacteroides→ThemeOf→controlling
  2. Parabacteroides→ThemeOf→rs10730843
  3. rs10730843→ThemeOf→relative abundance
  4. rs10730843→ThemeOf→Parabacteroides
  5. rs10730843→CauseOf→controlling
  6. relative abundance→ThemeOf→controlling
  7. relative abundance→ThemeOf→rs10730843
271 34074340 5909 The substitution of G to A for rs10730843 resulted in a significantly increased abundance of cecal Parabacteroides (Fig.
  1. rs10730843→CauseOf→increased
272 34074340 5913 Chickens with the TT genotype of rs314988200 had a higher abundance of cecal Megasphaera (0.19%) than those with the CT and CC genotypes (0.12% and 0.07%, respectively; Fig.
  1. cecal Megasphaera→ThemeOf→abundance
  2. cecal Megasphaera→ThemeOf→rs314988200
  3. cecal Megasphaera→ThemeOf→higher
  4. abundance→ThemeOf→rs314988200
  5. abundance→ThemeOf→higher
  6. abundance→ThemeOf→cecal Megasphaera
  7. rs314988200→ThemeOf→abundance
  8. rs314988200→CauseOf→higher
  9. rs314988200→ThemeOf→cecal Megasphaera
273 34074340 5918 We found that 4 suggestive significant SNPs were related to RFI (Fig.
  1. SNPs→ThemeOf→RFI
  2. SNPs→CauseOf→related
  3. RFI→ThemeOf→SNPs
  4. RFI→ThemeOf→related
274 34074340 5919 Among them, rs313164887 and rs312419026 resided in the intronic region of ELOVL fatty acid elongase 2 (ELOVL2) and phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 (PREX1), respectively.
  1. rs313164887→ThemeOf→ELOVL fatty acid elongase 2
  2. rs312419026→ThemeOf→ELOVL fatty acid elongase 2
  3. ELOVL fatty acid elongase 2→ThemeOf→rs312419026
  4. ELOVL fatty acid elongase 2→ThemeOf→rs313164887
275 34074340 5920 The other two variations, rs317782869 and rs316904613, were near the gene transient receptor potential cation channel subfamily A member 1 (TRPA1) and PREX1, respectively.
  1. PREX1→ThemeOf→rs317782869
  2. variations→ThemeOf→TRPA1
  3. rs317782869→ThemeOf→TRPA1
  4. variations→ThemeOf→PREX1
  5. rs317782869→ThemeOf→PREX1
  6. rs316904613→ThemeOf→TRPA1
  7. rs316904613→ThemeOf→PREX1
  8. TRPA1→ThemeOf→variations
  9. TRPA1→ThemeOf→rs316904613
  10. TRPA1→ThemeOf→rs317782869
  11. PREX1→ThemeOf→variations
  12. PREX1→ThemeOf→rs316904613
276 34074340 5921 In particular, rs316904613 and rs312419026 were highly linked to each other.
  1. rs316904613→CauseOf→linked
  2. rs312419026→CauseOf→linked
277 34074340 5923 The variation in rs317782869 resulted from a base transversion (A/C).
  1. variation→CauseOf→resulted from
  2. variation→ThemeOf→base transversion
  3. rs317782869→CauseOf→resulted from
  4. rs317782869→ThemeOf→base transversion
  5. base transversion→ThemeOf→rs317782869
  6. base transversion→ThemeOf→resulted from
  7. base transversion→ThemeOf→variation
278 34074340 5925 Regarding the SNP rs316904613, the G to C substitution led to a significant decrease in the RFI value (Fig.
  1. G to C→ThemeOf→RFI
  2. G to C→CauseOf→decrease
  3. RFI→ThemeOf→G to C
  4. RFI→ThemeOf→decrease
279 34074340 5927 Ileal Janthinobacterium and duodenal unclassified Peptostreptococcaceae were close to the significance level at the SNPs of rs313164887 and rs317782869, receptively (Fig.
  1. rs313164887→ThemeOf→Peptostreptococcaceae
  2. rs317782869→ThemeOf→Peptostreptococcaceae
  3. Peptostreptococcaceae→ThemeOf→rs313164887
  4. Peptostreptococcaceae→ThemeOf→rs317782869
280 34074340 5959 A recent study identified several genetic variants involved in the immune response and metabolism that were significantly associated with microbial diversity in the cecum of chickens.
  1. variants→ThemeOf→microbial
  2. variants→CauseOf→associated
  3. microbial→ThemeOf→variants
  4. microbial→ThemeOf→associated
281 34074340 5975 We then identified three suggestive significant loci:rs317782869, rs313164887, and rs316904613:which were near or distributed on three independent genes: TRPA1, ELOVL2, and PREX1.
  1. rs313164887→ThemeOf→TRPA1
  2. rs317782869→ThemeOf→ELOVL2
  3. rs313164887→ThemeOf→ELOVL2
  4. rs317782869→ThemeOf→PREX1
  5. rs313164887→ThemeOf→PREX1
  6. ELOVL2→ThemeOf→rs316904613
  7. rs316904613→ThemeOf→TRPA1
  8. ELOVL2→ThemeOf→rs313164887
  9. rs316904613→ThemeOf→ELOVL2
  10. ELOVL2→ThemeOf→rs317782869
  11. rs316904613→ThemeOf→PREX1
  12. PREX1→ThemeOf→rs316904613
  13. TRPA1→ThemeOf→rs316904613
  14. PREX1→ThemeOf→rs313164887
  15. TRPA1→ThemeOf→rs313164887
  16. PREX1→ThemeOf→rs317782869
  17. TRPA1→ThemeOf→rs317782869
  18. rs317782869→ThemeOf→TRPA1
282 34074340 5986 A significant difference in RFI was found among chicken individuals differing at specific genetic loci: rs317782869, rs313164887, and rs316904613.
  1. rs317782869→ThemeOf→RFI
  2. RFI→ThemeOf→rs317782869
  3. RFI→ThemeOf→rs316904613
  4. RFI→ThemeOf→rs313164887
  5. rs316904613→ThemeOf→RFI
  6. rs313164887→ThemeOf→RFI
283 34074340 6012 Our study strengthens the notion that both host genetic and gut microbial variations can lead to variation in feed efficiency.
  1. variations→CauseOf→lead to variation
284 34526973 6026 Moreover, Dajiang samples also contained abundant Pseudomonas, and Brevundimonas spp., while Halomonas, Staphylococcus, Lysinibacillus, Enterobacter, Streptococcus, Acinetobacter, and Halanaerobium spp.
  1. Halomonas→ThemeOf→Pseudomonas
  2. Pseudomonas→ThemeOf→Halomonas
285 34526973 6043 Specifically, reported that Lactobacillus sakei, Pediococcus acidilactici, and Weissella thailandensis significantly impact the quality of fermented sausage, while their metabolites provide a flavour profile.
  1. Weissella→CauseOf→impact
286 34526973 6091 At the genera level (Figure 4C), Bacillus, Lactobacillus, Tetragenococcus, and Weissella were the most abundant in the two groups.
  1. Tetragenococcus→ThemeOf→abundant
  2. Tetragenococcus→ThemeOf→Weissella
  3. Weissella→CauseOf→abundant
  4. Weissella→ThemeOf→Lactobacillus
  5. Weissella→ThemeOf→Tetragenococcus
  6. Weissella→ThemeOf→Bacillus
  7. Bacillus→ThemeOf→abundant
  8. Bacillus→ThemeOf→Weissella
  9. Lactobacillus→ThemeOf→abundant
  10. Lactobacillus→ThemeOf→Weissella
287 34530890 6219 The maximum hydrogen yields of the strain isolated from green waste were higher than those previously reported in the literature for other hydrogen-producing bacteria like C. perfringens 130 +- 3 mL of H2 per g of glucose; C. butyricum 136 +- 5 mL of H2 per g of glucose; C. diolis 150 mL of H2 per g of glucose; C. beijerinckii Fanp3 231 mL of H2 per g of glucose and C. tyrobutyricum JM1 223 ml of H2 per g of hexose.
  1. C. beijerinckii→CauseOf→higher
288 34530890 6233 Here, the gene expression modulation in time of the seven genes encoding for [FeFe]-hydrogenase enzymes with different structure types was investigated by RT-qPCR in the hydrogen-producing real biomasses waste, hence in presence of the autochthonous strains, both for the non-producers and the hydrogen-producing strains, either with applied bio-augmentation or not.
  1. RT-qPCR→CauseOf→modulation
  2. RT-qPCR→ThemeOf→gene expression
  3. gene expression→ThemeOf→modulation
  4. gene expression→ThemeOf→RT-qPCR
289 34530890 6260 During the first 23 h of dark fermentation, transcription levels of the genes encoding for the monomeric Cbei_1773 and the heterotrimeric Cbei_4110 [FeFe]-hydrogenases followed the same trend observed for hydrogen production; transcription levels of the gene encoding for monomeric Cbei_0327 showed a reverse trend compared with that of hydrogen.
  1. monomeric Cbei_0327→ThemeOf→transcription
  2. transcription→ThemeOf→transcription
  3. monomeric Cbei_0327→ThemeOf→Cbei_1773
  4. transcription→ThemeOf→monomeric Cbei_0327
  5. monomeric Cbei_0327→ThemeOf→transcription
  6. transcription→ThemeOf→Cbei_1773
  7. Cbei_1773→ThemeOf→transcription
  8. transcription→ThemeOf→Cbei_0327
  9. Cbei_1773→ThemeOf→monomeric Cbei_0327
  10. Cbei_1773→ThemeOf→Cbei_0327
  11. transcription→ThemeOf→monomeric Cbei_0327
  12. Cbei_1773→ThemeOf→transcription
  13. transcription→ThemeOf→Cbei_1773
  14. Cbei_0327→ThemeOf→transcription
  15. transcription→ThemeOf→Cbei_0327
  16. Cbei_0327→ThemeOf→Cbei_1773
  17. transcription→ThemeOf→transcription
  18. Cbei_0327→ThemeOf→transcription
290 34530890 6262 A relatively high hydrogen production level has been reported in Clostridia even at low transcripts amounts, given the good stability of the [FeFe] hydrogenases as active enzymes in the cell, which could explain the relatively high hydrogen accumulation between 23 and 144 h even with low transcripts detected at 72 and 144 h. In summary genes Cbei_1773, Cbei_4110, Cbei_0327 and Cbei_1901, which undergo larger changes in expression, seem to be related to hydrogen production, although with positive (Cbei_1773 and Cbei_4110) or negative (Cbei_0327) correlations, hence it would be interesting to further investigate their metabolic roles.
  1. Cbei_1773→CauseOf→related
  2. Cbei_1773→ThemeOf→hydrogen production
  3. Cbei_1773→CauseOf→related
  4. Cbei_1773→ThemeOf→hydrogen production
  5. hydrogen production→ThemeOf→related
  6. Cbei_4110→CauseOf→related
  7. hydrogen production→ThemeOf→Cbei_1773
  8. Cbei_4110→ThemeOf→hydrogen production
  9. hydrogen production→ThemeOf→Cbei_1773
  10. Cbei_4110→CauseOf→related
  11. hydrogen production→ThemeOf→Cbei_4110
  12. Cbei_4110→ThemeOf→hydrogen production
  13. hydrogen production→ThemeOf→Cbei_4110
  14. Cbei_0327→CauseOf→related
  15. hydrogen production→ThemeOf→Cbei_0327
  16. Cbei_0327→ThemeOf→hydrogen production
291 34530890 6263 In particular, the positive correlation of hydrogen production with Cbei_1773 is relevant given the attested good productivity and the oxygen-tolerance unique feature of the hydrogenase encoded by this gene.
  1. hydrogen production→ThemeOf→positive
  2. hydrogen production→ThemeOf→Cbei_1773
  3. Cbei_1773→CauseOf→positive
  4. Cbei_1773→ThemeOf→hydrogen production
292 34530890 6264 Genes Cbei_4000 and Cbei_3796 are possibly less related to hydrogen production and might be silent during dark fermentation.
  1. Cbei_4000→ThemeOf→hydrogen production
  2. Cbei_4000→CauseOf→less
  3. Cbei_4000→CauseOf→related
  4. Cbei_3796→ThemeOf→hydrogen production
  5. hydrogen production→ThemeOf→less
  6. Cbei_3796→CauseOf→less
  7. hydrogen production→ThemeOf→related
  8. Cbei_3796→CauseOf→related
  9. hydrogen production→ThemeOf→Cbei_4000
  10. hydrogen production→ThemeOf→Cbei_3796
  11. less→CauseOf→related
  12. related→CauseOf→less
293 34771152 6422 Furthermore, we divided the cobalamin biosynthetic pathways into three:aerobic and anaerobic biosynthesis of cob(II)yrinate a,c-diamide and biosynthesis of cobalamin from cob(II)yrinate a,c-diamide.
  1. biosynthesis→CauseOf→cob
  2. biosynthesis→CauseOf→cob
  3. cob→CauseOf→biosynthesis
  4. cob→CauseOf→biosynthesis
  5. cob→CauseOf→biosynthesis
  6. cob→CauseOf→biosynthesis
  7. biosynthesis→ThemeOf→biosynthesis
  8. biosynthesis→CauseOf→cob
  9. biosynthesis→CauseOf→cob
  10. biosynthesis→ThemeOf→biosynthesis
294 34771152 6429 In the studied the BC metagenome analysis showed that 32 PEGs were involved in the major biosynthetic pathways of tetrapyrrole cofactor (Table S2).
  1. PEGs→CauseOf→involved
295 34771152 6436 In the metagenome of BC, PEGs of all enzymes involved in the biosynthesis of uroporphyrinogen III using L-glutamate as the starting substrate were detected.
  1. uroporphyrinogen III→ThemeOf→PEGs
  2. PEGs→ThemeOf→uroporphyrinogen III
296 34771152 6439 The metagenomic analysis of the study showed the presence of PEGs of both enzymes.
  1. PEGs→CauseOf→presence
297 34771152 6441 In the studied BC, the PEG of the HemD enzyme was observed, but the matching PSs were not detected.
  1. PEG→CauseOf→observed
298 34771152 6449 The metagenomic analysis of the study showed the presence of PEGs of all enzymes, and metaproteomic analysis showed eight PSs matching both enzymes.
  1. PEGs→CauseOf→presence
299 34771152 6452 The metagenome of BC analyzed in this study showed the presence of PEG of HemE and four PSs matching the enzyme.
  1. PEG→CauseOf→presence
300 34771152 6454 The presence of PEGs of both enzymes and one PSs matching HemF and four PSs matching HemN were detected in analyses in the studied BC.
  1. PEGs→ThemeOf→PSs matching HemF
  2. PEGs→CauseOf→presence
  3. HemN→ThemeOf→PSs matching HemF
  4. HemN→ThemeOf→presence
  5. HemN→ThemeOf→PEGs
  6. PSs matching HemF→ThemeOf→HemN
  7. PSs matching HemF→ThemeOf→presence
  8. PSs matching HemF→ThemeOf→PEGs
  9. PEGs→ThemeOf→HemN
301 34771152 6456 In the BC metagenome, only PEGs of the latter enzyme HemJ were detected, whereas no PSs matching the enzyme HemJ were identified.
  1. PEGs→ThemeOf→HemJ
  2. HemJ→ThemeOf→PEGs
302 34771152 6460 The study results showed the presence of PEGs of both enzymes; however, four PSs matching only enzyme Cox15 were detected.
  1. Cox15→ThemeOf→presence
  2. PEGs→CauseOf→presence
  3. PEGs→ThemeOf→enzyme Cox15
  4. PEGs→ThemeOf→Cox15
  5. enzyme Cox15→ThemeOf→PEGs
  6. enzyme Cox15→ThemeOf→presence
  7. Cox15→ThemeOf→PEGs
303 34771152 6465 The results of this study showed PEG of HemH and five PSs of this enzyme in the investigated BC.
  1. HemH→ThemeOf→PEG
  2. PEG→ThemeOf→HemH
304 34771152 6466 Further, decarboxylation of Fe-coproporphyrin III substituents by hydrogen peroxide-dependent heme synthase (HemQ) or AdoMet-dependent heme synthase (Ahbd) results in the formation of heme B.
  1. heme B→ThemeOf→decarboxylation
  2. heme B→ThemeOf→formation
  3. Ahbd→ThemeOf→decarboxylation
  4. Ahbd→ThemeOf→heme B
  5. Ahbd→ThemeOf→formation
  6. decarboxylation→ThemeOf→Ahbd
  7. decarboxylation→ThemeOf→heme B
  8. decarboxylation→CauseOf→formation
  9. heme B→ThemeOf→Ahbd
305 34771152 6467 The results showed PEG matching only HemQ enzyme in the studied BC, whereas no PSs matching the enzyme HemQ or Ahbd were detected.
  1. PEG→ThemeOf→HemQ
  2. HemQ→ThemeOf→PEG
306 34771152 6471 In the investigated BC, only PEG of Ahbab was detected, but no PSs of any of these enzymes were found.
  1. PEG→ThemeOf→Ahbab
  2. Ahbab→ThemeOf→PEG
307 34771152 6476 Metagenomic results of this study showed only PEG of HemQ; however, no PSs matching HemQ or Ahbd enzyme were detected.
  1. PEG→ThemeOf→HemQ
  2. PEG→ThemeOf→Ahbd
  3. HemQ→ThemeOf→PEG
  4. Ahbd→ThemeOf→PEG
308 34771152 6481 The results showed that only PEGs of CbiK and CobN were involved in anaerobic and aerobic pathways, respectively, and the metaproteome of BC had two PSs matching CobB-CbiA.
  1. CobN→ThemeOf→PEGs
  2. PEGs→ThemeOf→CobN
  3. CobN→ThemeOf→metaproteome
  4. PEGs→CauseOf→involved
  5. CobN→ThemeOf→involved
  6. PEGs→ThemeOf→CbiK
  7. CbiK→ThemeOf→PEGs
  8. CbiK→ThemeOf→metaproteome
  9. metaproteome→ThemeOf→CobN
  10. CbiK→ThemeOf→involved
  11. metaproteome→ThemeOf→CbiK
309 34771152 6484 Cobalamin formation reactions can be carried out by using cob(II)yrinate a,c-diamide or cob(I)yrinate a, c diamide to form adenosyl cobyrinate a, c diamide.
  1. cob→CauseOf→adenosyl cobyrinate a
  2. adenosyl cobyrinate a→CauseOf→cob
310 34771152 6490 The PEG of CobQ was detected in this study, but the PS matching this enzyme was not found in the investigated BC.
  1. PEG→ThemeOf→CobQ
  2. CobQ→ThemeOf→PEG
311 34771152 6493 The results of this study showed PEG of CbiB, but PS matching this enzyme was not detected in the BC.
  1. PEG→ThemeOf→CbiB
  2. CbiB→ThemeOf→PEG
312 34771152 6496 This study showed PEG of CobP and five PSs matching this enzyme.
  1. PEG→ThemeOf→CobP
  2. CobP→ThemeOf→PEG
313 34771152 6505 The results showed PEG of PhpB, but PSs matching this enzyme were absent.
  1. PhpB→ThemeOf→absent
  2. PhpB→ThemeOf→PEG
  3. PEG→ThemeOf→PhpB
  4. PEG→CauseOf→absent
314 34771152 6507 PEGs of TonB, ExbB, and ExbD were identified in the BC metagenome.
  1. PEGs→ThemeOf→TonB
  2. TonB→ThemeOf→PEGs
315 34771152 6522 For example, 66% of PEGs and 33% of PSs were identified in the coproporphyrin-dependent pathway of heme biosynthesis.
  1. PEGs→ThemeOf→coproporphyrin-dependent
  2. coproporphyrin-dependent→ThemeOf→PEGs
316 34771152 6557 According to a study by Lawrence et al., cob(II)yrinate diamide may be extracted from the medium and converted to cobalamin.
  1. cob→CauseOf→cobalamin
  2. cobalamin→CauseOf→cob
  3. cobalamin→ThemeOf→converted
  4. cob→CauseOf→converted
317 34771152 6560 Various studies have shown that CobB-CbiA is utilized in the acetylation of proteins in the metabolism of microorganisms.
  1. CobB-CbiA→ThemeOf→acetylation
  2. acetylation→ThemeOf→CobB-CbiA
318 34991191 9126 CSI, L. helveticus, and L. paralimentarius accelerated the decline of silage pH.
  1. L. paralimentarius→CauseOf→accelerated
319 34991191 9128 Silage inoculated with L. paralimentarius produced less acetic acid and butyric acid.
  1. L. paralimentarius→CauseOf→less
320 34991191 9158 Similar results were observed in the major bacterial genera in all FTMRs belonging to Lactobacillus, covering more than 85% relative abundance, while Weissella, Pediococcus, Bacillus, Geobacillus, Staphylococcus, Paenibacillus, Erwinia, Xanthomonas, and Corynebacterium occupied the remaining portion (Figure 1a).
  1. Weissella→ThemeOf→Geobacillus
  2. Weissella→ThemeOf→Erwinia
  3. Bacillus→ThemeOf→Weissella
  4. Geobacillus→ThemeOf→Weissella
  5. Erwinia→ThemeOf→Weissella
  6. Weissella→ThemeOf→Bacillus
321 34991191 9185 In the current selected FTMRs, the dominant bacteria during ensiling belonged to the phylum Firmicute, comprising genera Lactobacillus, Lactococcus, Weissella, and Leuconostoc, while Lactobacillus exceeded 85% relative abundance.
  1. Lactobacillus→ThemeOf→Weissella
  2. Weissella→ThemeOf→Leuconostoc
  3. Weissella→ThemeOf→Lactococcus
  4. Weissella→ThemeOf→Lactobacillus
  5. Leuconostoc→ThemeOf→Weissella
  6. Lactococcus→ThemeOf→Weissella
322 34991191 9190 However, L. pontis (DSM 8475) was eliminated from the list during ensiling because of its slow growth.
  1. L. pontis→ThemeOf→eliminated
  2. L. pontis→ThemeOf→DSM 8475
  3. DSM 8475→ThemeOf→L. pontis
  4. DSM 8475→CauseOf→eliminated
323 34991191 9215 The current study supports the hypothesis that the homofermentative strain L. paralimentarius accelerated the decrease in pH values of corn stover silage.
  1. L. paralimentarius→ThemeOf→pH values of corn stover silage
  2. L. paralimentarius→CauseOf→accelerated
  3. accelerated→CauseOf→decrease
  4. decrease→CauseOf→accelerated
  5. pH values of corn stover silage→ThemeOf→decrease
  6. pH values of corn stover silage→ThemeOf→L. paralimentarius
  7. pH values of corn stover silage→ThemeOf→accelerated
  8. L. paralimentarius→CauseOf→decrease
324 34991191 9224 Similar to the effects of CSI, L. paralimentarius was highly effective in reducing the pH value and producing lactic acid in corn stover silage, which indicated that L. paralimentarius may be a promising ensiling inoculant for corn stover silage.
  1. L. paralimentarius→CauseOf→lactic acid
  2. L. paralimentarius→CauseOf→pH value
  3. lactic acid→ThemeOf→reducing
  4. lactic acid→ThemeOf→pH value
  5. lactic acid→CauseOf→L. paralimentarius
  6. pH value→ThemeOf→reducing
  7. pH value→ThemeOf→lactic acid
  8. pH value→CauseOf→L. paralimentarius
  9. L. paralimentarius→CauseOf→reducing
325 35010147 6842 According to the report of Zhanggen et al., Lactobacillus and Pediococcus are the dominant bacterial genus in Suancai, which includes species such as Pediococcus parvulus, Loigolactobacillus coryniformis, Lactiplantibacillus pentosus, and Levilactobacillus parabrevis.
  1. Pediococcus→CauseOf→Levilactobacillus
  2. Pediococcus→CauseOf→Lactiplantibacillus pentosus
  3. Levilactobacillus→CauseOf→Pediococcus
  4. Lactiplantibacillus pentosus→CauseOf→Pediococcus
326 35010147 6868 As displayed in Figure 1, the pH values of the four traditionally fermented vegetable samples ranged from 3.33 to 7.10, with PBN samples having the lowest pH value, and significantly lowered than SFWC samples.
  1. lowered→CauseOf→lowest
  2. pH value→ThemeOf→lowered
  3. PBN→CauseOf→lowest
  4. pH value→ThemeOf→PBN
  5. PBN→CauseOf→lowered
  6. pH value→ThemeOf→pH values
  7. PBN→ThemeOf→pH values
  8. PBN→ThemeOf→pH value
  9. pH values→ThemeOf→lowest
  10. pH values→ThemeOf→lowered
  11. pH values→ThemeOf→PBN
  12. pH values→ThemeOf→pH value
  13. lowest→CauseOf→lowered
  14. pH value→ThemeOf→lowest
327 35010147 6884 The abundance of Cyanobacteria was relatively higher in SFWC (82.6%), followed by PP (40.6%), PC (38.1%), and PBN (3.8%).
  1. abundance→ThemeOf→SFWC
  2. abundance→ThemeOf→higher
  3. Cyanobacteria→ThemeOf→SFWC
  4. Cyanobacteria→ThemeOf→higher
  5. Cyanobacteria→ThemeOf→abundance
  6. SFWC→ThemeOf→Cyanobacteria
  7. SFWC→CauseOf→higher
  8. SFWC→ThemeOf→abundance
  9. abundance→ThemeOf→Cyanobacteria
328 35010147 6891 However, Lactobacillus was not detected in SFWC samples, while Weissella was the predominant genus in SFWC samples (7.7%).
  1. Lactobacillus→ThemeOf→Weissella
  2. Weissella→ThemeOf→Lactobacillus
329 35010147 6893 In addition, Salinivibrio, Weissella, Arcobacter, Halomonas, and Terasakiispira were more abundant in PBN samples.
  1. Terasakiispira→ThemeOf→PBN
  2. Halomonas→ThemeOf→Arcobacter
  3. Terasakiispira→ThemeOf→Arcobacter
  4. Halomonas→ThemeOf→Weissella
  5. Terasakiispira→ThemeOf→Weissella
  6. Weissella→CauseOf→abundant
  7. Arcobacter→ThemeOf→abundant
  8. Weissella→ThemeOf→PBN
  9. PBN→ThemeOf→abundant
  10. Arcobacter→ThemeOf→PBN
  11. Weissella→ThemeOf→Terasakiispira
  12. PBN→ThemeOf→Terasakiispira
  13. Arcobacter→ThemeOf→Terasakiispira
  14. Weissella→ThemeOf→Arcobacter
  15. PBN→ThemeOf→Arcobacter
  16. Arcobacter→ThemeOf→Halomonas
  17. Weissella→ThemeOf→Halomonas
  18. PBN→ThemeOf→Halomonas
  19. Arcobacter→ThemeOf→Weissella
  20. PBN→ThemeOf→Weissella
  21. Halomonas→ThemeOf→abundant
  22. Terasakiispira→ThemeOf→abundant
  23. Halomonas→ThemeOf→PBN
330 35010147 6908 Tartaric acid had the greatest effect on the bacterial composition, followed by malic acid, TA, and lactic acid.
  1. lactic→ThemeOf→effect
  2. lactic→ThemeOf→Tartaric
  3. bacterial composition→ThemeOf→effect
  4. bacterial composition→ThemeOf→Tartaric
  5. Tartaric→CauseOf→effect
  6. Tartaric→ThemeOf→lactic
  7. Tartaric→ThemeOf→bacterial composition
331 35010147 6947 This is the first study to report that tartaric acid and malic acid affect the structure of bacterial communities in fermented vegetables.
  1. tartaric→CauseOf→affect
332 35010147 6950 Thus, it is necessary to explore the influence of tartaric acid and malic acid on microbial communities in the production of SFWC and PBN samples.
  1. tartaric→CauseOf→influence
333 35010187 6971 Thirteen kinds of VOCs were different between the two raw materials and the correlation between the microorganisms and VOCs showed that cabbage paocai had stronger correlations than radish paocai for the most significant relationship between 4-isopropylbenzyl alcohol, alpha-cadinol, terpinolene and isobutyl phenylacetate.
  1. terpinolene→ThemeOf→stronger
  2. cabbage→CauseOf→stronger
  3. isobutyl phenylacetate→ThemeOf→stronger
  4. terpinolene→ThemeOf→4-isopropylbenzyl alcohol
  5. cabbage→ThemeOf→terpinolene
  6. isobutyl phenylacetate→ThemeOf→terpinolene
  7. terpinolene→ThemeOf→cabbage
  8. cabbage→ThemeOf→4-isopropylbenzyl alcohol
  9. isobutyl phenylacetate→ThemeOf→4-isopropylbenzyl alcohol
  10. terpinolene→ThemeOf→alpha-cadinol
  11. cabbage→ThemeOf→alpha-cadinol
  12. isobutyl phenylacetate→ThemeOf→cabbage
  13. terpinolene→ThemeOf→isobutyl phenylacetate
  14. cabbage→ThemeOf→isobutyl phenylacetate
  15. isobutyl phenylacetate→ThemeOf→alpha-cadinol
  16. 4-isopropylbenzyl alcohol→ThemeOf→stronger
  17. alpha-cadinol→ThemeOf→stronger
  18. 4-isopropylbenzyl alcohol→ThemeOf→terpinolene
  19. alpha-cadinol→ThemeOf→terpinolene
  20. 4-isopropylbenzyl alcohol→ThemeOf→cabbage
  21. alpha-cadinol→ThemeOf→4-isopropylbenzyl alcohol
  22. 4-isopropylbenzyl alcohol→ThemeOf→alpha-cadinol
  23. alpha-cadinol→ThemeOf→cabbage
  24. 4-isopropylbenzyl alcohol→ThemeOf→isobutyl phenylacetate
  25. alpha-cadinol→ThemeOf→isobutyl phenylacetate
334 35010187 7027 Among these, linalool registered the highest proportions reaching up to 35% and 41.6% in the red radish and cabbage paocais, respectively, similar to previous studies.
  1. linalool→CauseOf→highest
335 35010187 7029 Other alcohols were also evaluated to have a positive effect on paocai's flavor with alpha-terpineol contributing a floral typically lilac odor; eucalyptol with a eucalyptus, herbal and camphor odor; and nerol with notes of roses.
  1. eucalyptol→CauseOf→contributing
  2. alpha-terpineol→CauseOf→contributing
336 35010187 7034 Among the sulfides, dimethyl disulfide and dimethyl trisulfide were uniquely found in the red radish paocai, whereas 3-butenylisothiocyanate was found to be the unique sulfide in the cabbage paocai.
  1. dimethyl→CauseOf→found
  2. dimethyl→CauseOf→dimethyl trisulfide
  3. dimethyl trisulfide→CauseOf→dimethyl
  4. dimethyl trisulfide→ThemeOf→found
337 35052575 7084 To better decipher the systems-based link between the metal-microbiome-gut-brain axis, it is important to interpret how microbial dysbiosis, in relation to oxidative stress from metals, leads to a pro-inflammatory environment and how the gut microbiome influences the remediation of xenobiotic metals.
  1. gut→ThemeOf→leads to
  2. remediation→ThemeOf→gut
  3. gut→ThemeOf→leads to
  4. dysbiosis→ThemeOf→gut
  5. gut→ThemeOf→dysbiosis
  6. remediation→ThemeOf→microbial
  7. gut→ThemeOf→dysbiosis
  8. dysbiosis→ThemeOf→influences
  9. gut→ThemeOf→pro-inflammatory
  10. remediation→ThemeOf→gut
  11. gut→ThemeOf→pro-inflammatory
  12. dysbiosis→ThemeOf→leads to
  13. microbial→ThemeOf→gut
  14. remediation→ThemeOf→influences
  15. influences→CauseOf→leads to
  16. dysbiosis→ThemeOf→pro-inflammatory
  17. microbial→ThemeOf→remediation
  18. remediation→ThemeOf→leads to
  19. influences→CauseOf→pro-inflammatory
  20. pro-inflammatory→CauseOf→influences
  21. microbial→ThemeOf→gut
  22. remediation→ThemeOf→dysbiosis
  23. leads to→CauseOf→influences
  24. pro-inflammatory→CauseOf→leads to
  25. microbial→CauseOf→influences
  26. remediation→ThemeOf→pro-inflammatory
  27. leads to→CauseOf→pro-inflammatory
  28. gut→ThemeOf→microbial
  29. microbial→CauseOf→leads to
  30. gut→ThemeOf→microbial
  31. dysbiosis→ThemeOf→gut
  32. gut→ThemeOf→remediation
  33. microbial→ThemeOf→dysbiosis
  34. gut→ThemeOf→remediation
  35. dysbiosis→ThemeOf→microbial
  36. gut→ThemeOf→influences
  37. microbial→CauseOf→pro-inflammatory
  38. gut→ThemeOf→influences
  39. dysbiosis→ThemeOf→remediation
338 35052575 7093 Improper metal binding associated with oxidative stress leads to protein misfolding and aggregation.
  1. Improper→ThemeOf→binding
  2. Improper→CauseOf→leads to
  3. binding→ThemeOf→leads to
  4. binding→ThemeOf→Improper
339 35052575 7095 Protein misfolding is the hallmark of numerous neurodegenerative diseases such as Alzheimer's Disease, Lewy Body Dementia, Huntington's Disease, and prion diseases, and is similarly underlined with metal stress.
  1. misfolding→ThemeOf→Protein
  2. Alzheimer's Disease→ThemeOf→misfolding
  3. misfolding→ThemeOf→Huntington's Disease
  4. misfolding→ThemeOf→Alzheimer's Disease
  5. Lewy Body Dementia→ThemeOf→misfolding
  6. misfolding→ThemeOf→prion diseases
  7. Huntington's Disease→ThemeOf→misfolding
  8. hallmark of numerous neurodegenerative diseases→ThemeOf→misfolding
  9. prion diseases→ThemeOf→misfolding
  10. misfolding→ThemeOf→hallmark of numerous neurodegenerative diseases
  11. Protein→ThemeOf→misfolding
  12. misfolding→ThemeOf→Lewy Body Dementia
340 35052575 7101 Different valence states or species of Mn (Mn2+ or Mn3+) play significant roles in Mn neurotoxicity, in which Mn3+ is more toxic than Mn2+.
  1. neurotoxicity→CauseOf→Mn3+
  2. Mn3+→CauseOf→neurotoxicity
341 35052575 7119 The dysregulation of dopamine transmission from the substantia nigra to the striatum, a region associated with motor symptoms in Mn neurotoxicity, is known to prevent dopamine release, thereby leading to elicit behavioral responses that are similar to both PD and Mn neurotoxicity.
  1. neurotoxicity→ThemeOf→prevent
  2. neurotoxicity→ThemeOf→dopamine transmission
  3. dopamine transmission→ThemeOf→leading
  4. dysregulation→ThemeOf→neurotoxicity
  5. neurotoxicity→ThemeOf→elicit
  6. neurotoxicity→ThemeOf→dopamine release
  7. dopamine release→ThemeOf→prevent
  8. dysregulation→ThemeOf→neurotoxicity
  9. neurotoxicity→ThemeOf→neurotoxicity
  10. neurotoxicity→ThemeOf→dysregulation
  11. dopamine release→ThemeOf→elicit
  12. dysregulation→ThemeOf→dopamine transmission
  13. neurotoxicity→ThemeOf→dopamine transmission
  14. neurotoxicity→ThemeOf→leading
  15. dopamine release→ThemeOf→neurotoxicity
  16. dysregulation→ThemeOf→dopamine release
  17. neurotoxicity→ThemeOf→dopamine release
  18. dopamine transmission→ThemeOf→prevent
  19. dopamine release→ThemeOf→neurotoxicity
  20. dysregulation→CauseOf→leading
  21. neurotoxicity→ThemeOf→dysregulation
  22. dopamine transmission→ThemeOf→elicit
  23. dopamine release→ThemeOf→dopamine transmission
  24. leading→CauseOf→prevent
  25. prevent→CauseOf→elicit
  26. neurotoxicity→ThemeOf→leading
  27. dopamine transmission→ThemeOf→neurotoxicity
  28. dopamine release→ThemeOf→dysregulation
  29. leading→CauseOf→elicit
  30. prevent→CauseOf→leading
  31. neurotoxicity→ThemeOf→prevent
  32. dopamine transmission→ThemeOf→neurotoxicity
  33. dopamine release→ThemeOf→leading
  34. elicit→CauseOf→prevent
  35. neurotoxicity→ThemeOf→elicit
  36. dopamine transmission→ThemeOf→dopamine release
  37. dysregulation→CauseOf→prevent
  38. elicit→CauseOf→leading
  39. neurotoxicity→ThemeOf→neurotoxicity
  40. dopamine transmission→ThemeOf→dysregulation
  41. dysregulation→CauseOf→elicit
342 35052575 7132 Hg differs from other metals with regard to cellular transport; it does not require human macrophages or other immuno-transport mechanisms, rather MeHg is readily able to penetrate the blood-brain barrier (BBB).
  1. MeHg→CauseOf→penetrate
  2. age→ThemeOf→MeHg
  3. age→ThemeOf→penetrate
  4. MeHg→ThemeOf→age
343 35052575 7139 Through these pathomechanisms, MeHg exposure leads to apoptosis and neurotoxicity through dysfunctional cell narrowing, chromatin condensation, the modification of cytochrome C flux, and well-described oxidative stress insults to the mitochondria.
  1. MeHg→CauseOf→modification
  2. leads to→CauseOf→modification
  3. MeHg→CauseOf→leads to
  4. modification→CauseOf→leads to
344 35052575 7156 Irregularities in the regulation of this gene lead to chronic ferritin release and neurotoxicity.
  1. neurotoxicity→ThemeOf→lead
  2. Irregularities→ThemeOf→regulation
  3. neurotoxicity→ThemeOf→regulation
  4. neurotoxicity→ThemeOf→Irregularities
  5. regulation→ThemeOf→chronic ferritin release
  6. regulation→ThemeOf→lead
  7. chronic ferritin release→ThemeOf→lead
  8. regulation→ThemeOf→neurotoxicity
  9. chronic ferritin release→ThemeOf→neurotoxicity
  10. regulation→ThemeOf→Irregularities
  11. chronic ferritin release→ThemeOf→regulation
  12. Irregularities→ThemeOf→chronic ferritin release
  13. chronic ferritin release→ThemeOf→Irregularities
  14. Irregularities→CauseOf→lead
  15. neurotoxicity→ThemeOf→chronic ferritin release
  16. Irregularities→ThemeOf→neurotoxicity
345 35052575 7164 However, recent studies highlight that heavy metal exposure alters both the native gut microbiota and intestinal physiology.
  1. heavy metal→CauseOf→alters
  2. heavy metal→ThemeOf→gut
  3. gut→ThemeOf→heavy metal
  4. gut→ThemeOf→alters
346 35052575 7165 Specifically, additional damage due to heavy metals disruption of the gut epithelium leads to a heightened inflammatory response, thus disrupting GI tight junctions and promoting systemic inflammation by inciting changes in microbial abundance and microbial-mediated metabolic changes.
  1. inflammation→ThemeOf→promoting
  2. disruption→ThemeOf→age
  3. promoting→CauseOf→heightened
  4. inflammatory response→ThemeOf→gut
  5. gut→ThemeOf→disruption
  6. inflammation→ThemeOf→heightened
  7. disruption→ThemeOf→gut
  8. heightened→CauseOf→disrupting
  9. age→ThemeOf→disrupting
  10. gut→ThemeOf→heavy metals disruption
  11. inflammation→ThemeOf→inflammatory response
  12. heavy metals disruption→CauseOf→disrupting
  13. heightened→CauseOf→promoting
  14. age→ThemeOf→inflammation
  15. gut→ThemeOf→promoting
  16. inflammation→ThemeOf→age
  17. heavy metals disruption→ThemeOf→inflammation
  18. inflammatory response→ThemeOf→disrupting
  19. age→ThemeOf→disruption
  20. gut→ThemeOf→heightened
  21. inflammation→ThemeOf→gut
  22. heavy metals disruption→CauseOf→promoting
  23. inflammatory response→ThemeOf→inflammation
  24. age→ThemeOf→heavy metals disruption
  25. gut→ThemeOf→inflammatory response
  26. disrupting→CauseOf→promoting
  27. disruption→CauseOf→disrupting
  28. heavy metals disruption→CauseOf→heightened
  29. inflammatory response→ThemeOf→disruption
  30. age→ThemeOf→promoting
  31. disrupting→CauseOf→heightened
  32. disruption→ThemeOf→inflammation
  33. heavy metals disruption→ThemeOf→inflammatory response
  34. inflammatory response→ThemeOf→heavy metals disruption
  35. age→ThemeOf→heightened
  36. inflammation→ThemeOf→disrupting
  37. disruption→CauseOf→promoting
  38. heavy metals disruption→ThemeOf→age
  39. inflammatory response→ThemeOf→promoting
  40. age→ThemeOf→inflammatory response
  41. inflammation→ThemeOf→disruption
  42. disruption→CauseOf→heightened
  43. heavy metals disruption→ThemeOf→gut
  44. inflammatory response→ThemeOf→heightened
  45. gut→ThemeOf→disrupting
  46. inflammation→ThemeOf→heavy metals disruption
  47. disruption→ThemeOf→inflammatory response
  48. promoting→CauseOf→disrupting
  49. inflammatory response→ThemeOf→age
  50. gut→ThemeOf→inflammation
347 35052575 7208 Most recently, berberine supplementation was reported to increase dopamine levels in the brains of mice with PD by modulating the gut microbiota, such as Enterococcus spp..
  1. gut→ThemeOf→increase
  2. gut→ThemeOf→dopamine levels
  3. gut→ThemeOf→modulating
  4. gut→ThemeOf→berberine
  5. modulating→CauseOf→increase
  6. increase→CauseOf→modulating
  7. berberine→CauseOf→increase
  8. dopamine levels→ThemeOf→increase
  9. berberine→ThemeOf→dopamine levels
  10. dopamine levels→ThemeOf→gut
  11. berberine→ThemeOf→gut
  12. dopamine levels→ThemeOf→modulating
  13. berberine→CauseOf→modulating
  14. dopamine levels→ThemeOf→berberine
348 35052575 7235 For example, human colorectal cells with DMT1 expression knocked-down have a decreased uptake of Fe2+, Pb2+, and Cd2+.
  1. knocked-down→CauseOf→decreased
349 35052575 7236 Organic anion transporters that are involved in intestinal uptake of CH3Hg+ through Zinc carriers (ZIP8 and ZIP14) interact with both Hg2+ and Mn2+.
  1. CH3Hg+→CauseOf→involved
  2. ZIP8→ThemeOf→CH3Hg+
  3. ZIP8→ThemeOf→involved
  4. ZIP14→ThemeOf→CH3Hg+
  5. ZIP14→ThemeOf→involved
  6. CH3Hg+→ThemeOf→ZIP14
  7. CH3Hg+→ThemeOf→ZIP8
350 35052575 7258 While the uptake mechanisms are not clear, dietary Fe may influence Mn transport through non-competitive mechanisms.
  1. dietary→CauseOf→influence
351 35052575 7261 LAT-1 is located in endothelial and pericyte cell membranes and recruits MeHg into the brain; the shuttling of MeHg into the brain further induces the dysfunction of astrocytes and pericytes by increasing BBB permeability.
  1. shuttling→ThemeOf→dysfunction
  2. LAT-1→CauseOf→MeHg
  3. dysfunction→ThemeOf→increasing
  4. shuttling→CauseOf→induces
  5. LAT-1→ThemeOf→dysfunction
  6. induces→CauseOf→increasing
  7. shuttling→ThemeOf→BBB permeability
  8. LAT-1→ThemeOf→induces
  9. BBB permeability→ThemeOf→shuttling
  10. shuttling→CauseOf→increasing
  11. LAT-1→ThemeOf→BBB permeability
  12. BBB permeability→CauseOf→MeHg
  13. MeHg→CauseOf→LAT-1
  14. LAT-1→ThemeOf→increasing
  15. BBB permeability→ThemeOf→LAT-1
  16. MeHg→CauseOf→dysfunction
  17. dysfunction→ThemeOf→shuttling
  18. BBB permeability→ThemeOf→dysfunction
  19. MeHg→CauseOf→induces
  20. dysfunction→CauseOf→MeHg
  21. BBB permeability→ThemeOf→induces
  22. MeHg→CauseOf→BBB permeability
  23. dysfunction→ThemeOf→LAT-1
  24. BBB permeability→ThemeOf→increasing
  25. MeHg→CauseOf→increasing
  26. dysfunction→ThemeOf→induces
  27. increasing→CauseOf→induces
  28. shuttling→ThemeOf→LAT-1
  29. LAT-1→ThemeOf→shuttling
  30. dysfunction→ThemeOf→BBB permeability
352 35052575 7262 Specifically, MeHg exposure inhibits aquaporin AQP4 in astrocytes, leading to alterations in water balance and, consequently, contributing to neurodegeneration.
  1. leading→CauseOf→inhibits
  2. alterations→CauseOf→contributing
  3. AQP4→ThemeOf→leading
  4. leading→CauseOf→contributing
  5. neurodegeneration→ThemeOf→leading
  6. AQP4→ThemeOf→MeHg
  7. MeHg→CauseOf→leading
  8. neurodegeneration→ThemeOf→MeHg
  9. AQP4→ThemeOf→alterations
  10. MeHg→CauseOf→alterations
  11. neurodegeneration→ThemeOf→alterations
  12. AQP4→ThemeOf→neurodegeneration
  13. MeHg→ThemeOf→neurodegeneration
  14. neurodegeneration→ThemeOf→inhibits
  15. AQP4→ThemeOf→inhibits
  16. MeHg→CauseOf→inhibits
  17. neurodegeneration→ThemeOf→AQP4
  18. AQP4→ThemeOf→contributing
  19. MeHg→ThemeOf→AQP4
  20. neurodegeneration→ThemeOf→contributing
  21. contributing→CauseOf→leading
  22. MeHg→CauseOf→contributing
  23. inhibits→CauseOf→leading
  24. contributing→CauseOf→alterations
  25. alterations→CauseOf→leading
  26. inhibits→CauseOf→alterations
  27. contributing→CauseOf→inhibits
  28. leading→CauseOf→alterations
  29. alterations→CauseOf→inhibits
  30. inhibits→CauseOf→contributing
353 35052575 7267 Alterations in tight-junction proteins such as ZO-1 translate to uncontrollable Cd uptake in the brain, which in turn induces the impairment of neural tissue functioning.
  1. uncontrollable→ThemeOf→Alterations
  2. Alterations→CauseOf→induces
  3. uncontrollable→ThemeOf→ZO-1
  4. ZO-1→ThemeOf→uncontrollable
  5. uncontrollable→ThemeOf→induces
  6. ZO-1→ThemeOf→neural tissue functioning
  7. neural tissue functioning→ThemeOf→uncontrollable
  8. ZO-1→ThemeOf→Alterations
  9. neural tissue functioning→ThemeOf→Alterations
  10. ZO-1→ThemeOf→induces
  11. neural tissue functioning→ThemeOf→ZO-1
  12. neural tissue functioning→ThemeOf→induces
  13. Alterations→ThemeOf→uncontrollable
  14. Alterations→ThemeOf→neural tissue functioning
  15. uncontrollable→ThemeOf→neural tissue functioning
  16. Alterations→ThemeOf→ZO-1
354 35052575 7270 Metal stress upon the hippocampus is linked to accelerated aging, memory loss, and dementia.
  1. Metal stress→CauseOf→linked
  2. dementia→ThemeOf→memory loss
  3. dementia→ThemeOf→Metal stress
  4. dementia→ThemeOf→linked
  5. memory loss→ThemeOf→Metal stress
  6. memory loss→ThemeOf→dementia
  7. memory loss→ThemeOf→linked
  8. Metal stress→ThemeOf→memory loss
  9. Metal stress→ThemeOf→dementia
355 35052575 7280 Oxidative stress disrupts gut and BBB barriers, leading to alpha-synuclein misfolding, aggregation, and subsequent neuronal damage in both ENS and CNS.
  1. gut→ThemeOf→disrupts
  2. alpha-synuclein→ThemeOf→leading to
  3. aggregation→ThemeOf→gut
  4. alpha-synuclein→ThemeOf→disrupts
  5. leading to→CauseOf→disrupts
  6. aggregation→ThemeOf→alpha-synuclein
  7. disrupts→CauseOf→leading to
  8. misfolding→ThemeOf→gut
  9. gut→ThemeOf→misfolding
  10. misfolding→ThemeOf→alpha-synuclein
  11. gut→ThemeOf→aggregation
  12. alpha-synuclein→ThemeOf→misfolding
  13. misfolding→CauseOf→leading to
  14. alpha-synuclein→ThemeOf→aggregation
  15. misfolding→CauseOf→disrupts
  16. gut→ThemeOf→leading to
356 35052575 7287 Alterations in microbiota stimulate ROS production by activating the cytoplasmic NLRP3-associated inflammasome, regulating the maturation and secretion of pro-inflammatory cytokines, such as IL-1beta in epithelial cells, thereby promoting Th17 cell differentiation.
  1. microbiota→ThemeOf→promoting
  2. activating→CauseOf→regulating
  3. promoting→CauseOf→stimulate
  4. Alterations→ThemeOf→Th1
  5. ROS production→ThemeOf→maturation
  6. maturation→ThemeOf→Alterations
  7. Th1→ThemeOf→Alterations
  8. NLRP3→ThemeOf→ROS production
  9. secretion→ThemeOf→IL-1beta
  10. microbiota→ThemeOf→Alterations
  11. IL-1beta→ThemeOf→stimulate
  12. promoting→CauseOf→activating
  13. Alterations→ThemeOf→NLRP3
  14. ROS production→ThemeOf→Th1
  15. maturation→ThemeOf→ROS production
  16. Th1→ThemeOf→ROS production
  17. NLRP3→ThemeOf→maturation
  18. secretion→ThemeOf→promoting
  19. microbiota→ThemeOf→ROS production
  20. IL-1beta→ThemeOf→microbiota
  21. promoting→CauseOf→regulating
  22. Alterations→CauseOf→regulating
  23. ROS production→ThemeOf→NLRP3
  24. maturation→ThemeOf→Th1
  25. Th1→ThemeOf→maturation
  26. NLRP3→ThemeOf→regulating
  27. secretion→ThemeOf→Alterations
  28. microbiota→ThemeOf→maturation
  29. IL-1beta→ThemeOf→activating
  30. Alterations→CauseOf→stimulate
  31. Alterations→ThemeOf→secretion
  32. ROS production→ThemeOf→regulating
  33. maturation→ThemeOf→NLRP3
  34. Th1→ThemeOf→regulating
  35. NLRP3→ThemeOf→secretion
  36. secretion→ThemeOf→ROS production
  37. stimulate→CauseOf→activating
  38. microbiota→ThemeOf→Th1
  39. IL-1beta→ThemeOf→promoting
  40. Alterations→ThemeOf→microbiota
  41. ROS production→ThemeOf→stimulate
  42. ROS production→ThemeOf→secretion
  43. maturation→ThemeOf→regulating
  44. Th1→ThemeOf→secretion
  45. regulating→CauseOf→stimulate
  46. secretion→ThemeOf→maturation
  47. stimulate→CauseOf→promoting
  48. microbiota→ThemeOf→NLRP3
  49. IL-1beta→ThemeOf→Alterations
  50. Alterations→CauseOf→activating
  51. ROS production→ThemeOf→microbiota
  52. maturation→ThemeOf→stimulate
  53. maturation→ThemeOf→secretion
  54. NLRP3→ThemeOf→stimulate
  55. regulating→CauseOf→activating
  56. secretion→ThemeOf→Th1
  57. stimulate→CauseOf→regulating
  58. microbiota→ThemeOf→regulating
  59. IL-1beta→ThemeOf→ROS production
  60. Alterations→ThemeOf→IL-1beta
  61. ROS production→ThemeOf→activating
  62. maturation→ThemeOf→microbiota
  63. Th1→ThemeOf→stimulate
  64. NLRP3→ThemeOf→microbiota
  65. regulating→CauseOf→promoting
  66. secretion→ThemeOf→NLRP3
  67. microbiota→ThemeOf→stimulate
  68. microbiota→ThemeOf→secretion
  69. IL-1beta→ThemeOf→maturation
  70. Alterations→CauseOf→promoting
  71. ROS production→ThemeOf→IL-1beta
  72. maturation→ThemeOf→activating
  73. Th1→ThemeOf→microbiota
  74. NLRP3→ThemeOf→activating
  75. secretion→ThemeOf→stimulate
  76. secretion→ThemeOf→regulating
  77. microbiota→ThemeOf→activating
  78. activating→CauseOf→stimulate
  79. IL-1beta→ThemeOf→regulating
  80. Alterations→ThemeOf→ROS production
  81. ROS production→ThemeOf→promoting
  82. maturation→ThemeOf→IL-1beta
  83. Th1→ThemeOf→activating
  84. NLRP3→ThemeOf→promoting
  85. secretion→ThemeOf→microbiota
  86. microbiota→ThemeOf→IL-1beta
  87. activating→CauseOf→promoting
  88. IL-1beta→ThemeOf→secretion
  89. Alterations→ThemeOf→maturation
  90. ROS production→ThemeOf→Alterations
  91. maturation→ThemeOf→promoting
  92. Th1→ThemeOf→promoting
  93. NLRP3→ThemeOf→Alterations
  94. secretion→ThemeOf→activating
357 35052575 7290 The changes in the microbiome are related to beneficial effects, such as rebalancing in gut microbial communities, and the attenuation of inflammation, all highlight that modulation of the gut microbiota via inflammasome signaling likely alters brain functioning.
  1. modulation→ThemeOf→gut
  2. modulation→CauseOf→alters
  3. gut→ThemeOf→brain functioning
  4. rebalancing→ThemeOf→gut
  5. brain functioning→ThemeOf→gut
  6. gut→ThemeOf→modulation
  7. modulation→ThemeOf→gut
  8. gut→ThemeOf→alters
  9. gut→ThemeOf→brain functioning
  10. modulation→ThemeOf→rebalancing
  11. gut→ThemeOf→inflammation
  12. gut→ThemeOf→modulation
  13. gut→ThemeOf→rebalancing
  14. gut→ThemeOf→alters
  15. inflammation→ThemeOf→gut
  16. gut→ThemeOf→inflammation
  17. rebalancing→ThemeOf→gut
  18. brain functioning→ThemeOf→gut
  19. gut→ThemeOf→rebalancing
  20. rebalancing→ThemeOf→modulation
  21. inflammation→ThemeOf→gut
  22. rebalancing→ThemeOf→alters
358 35052575 7302 Mitochondrial oxidative stress further exacerbates ROS production and drives neuroinflammation in the brain by perturbing muscarinic and dopaminergic receptors.
  1. ROS production→ThemeOf→perturbing
  2. Mitochondrial→CauseOf→exacerbates
  3. ROS production→ThemeOf→Mitochondrial
  4. Mitochondrial→CauseOf→drives
  5. inflammation→ThemeOf→ROS production
  6. exacerbates→CauseOf→drives
  7. Mitochondrial→CauseOf→perturbing
  8. inflammation→ThemeOf→exacerbates
  9. exacerbates→CauseOf→perturbing
  10. inflammation→ThemeOf→drives
  11. drives→CauseOf→exacerbates
  12. inflammation→ThemeOf→perturbing
  13. drives→CauseOf→perturbing
  14. inflammation→ThemeOf→Mitochondrial
  15. perturbing→CauseOf→exacerbates
  16. ROS production→ThemeOf→inflammation
  17. perturbing→CauseOf→drives
  18. ROS production→ThemeOf→exacerbates
  19. Mitochondrial→ThemeOf→inflammation
  20. ROS production→ThemeOf→drives
  21. Mitochondrial→ThemeOf→ROS production
359 35052575 7303 Furthermore, the Mn3+ oxidation of dopamine increases the relative concentration of localized, oxidized dopamine, resulting in increased oxidative stress.
  1. Mn3+ oxidation→CauseOf→increases
  2. Mn3+ oxidation→CauseOf→increased
  3. dopamine→ThemeOf→Mn3+ oxidation
  4. dopamine→ThemeOf→increases
  5. dopamine→ThemeOf→increased
  6. Mn3+ oxidation→ThemeOf→dopamine
  7. increases→CauseOf→increased
  8. increased→CauseOf→increases
360 35052575 7307 For example, MeHg causes apoptosis within 18 h of exposure by impairing mitochondrial mRNA expression, inciting the mutation of mtDNA, and leading to the excessive production of ROS.
  1. excessive→CauseOf→leading to
  2. mtDNA→ThemeOf→mutation
  3. mutation→ThemeOf→mitochondrial mRNA
  4. mitochondrial mRNA→ThemeOf→MeHg
  5. MeHg→ThemeOf→mtDNA
  6. production of ROS→ThemeOf→excessive
  7. excessive→CauseOf→inciting
  8. mtDNA→ThemeOf→mitochondrial mRNA
  9. mutation→CauseOf→inciting
  10. mitochondrial mRNA→ThemeOf→impairing
  11. MeHg→ThemeOf→mitochondrial mRNA
  12. production of ROS→ThemeOf→leading to
  13. excessive→CauseOf→impairing
  14. mtDNA→ThemeOf→inciting
  15. mutation→CauseOf→impairing
  16. mitochondrial mRNA→ThemeOf→production of ROS
  17. MeHg→CauseOf→inciting
  18. production of ROS→ThemeOf→mtDNA
  19. leading to→CauseOf→causes
  20. mtDNA→ThemeOf→MeHg
  21. mutation→ThemeOf→production of ROS
  22. inciting→CauseOf→causes
  23. MeHg→CauseOf→impairing
  24. production of ROS→ThemeOf→mutation
  25. leading to→CauseOf→excessive
  26. mtDNA→ThemeOf→impairing
  27. mitochondrial mRNA→ThemeOf→causes
  28. inciting→CauseOf→excessive
  29. MeHg→ThemeOf→production of ROS
  30. production of ROS→ThemeOf→mitochondrial mRNA
  31. causes→CauseOf→excessive
  32. leading to→CauseOf→inciting
  33. mtDNA→ThemeOf→production of ROS
  34. mitochondrial mRNA→ThemeOf→excessive
  35. inciting→CauseOf→leading to
  36. impairing→CauseOf→causes
  37. production of ROS→ThemeOf→inciting
  38. causes→CauseOf→leading to
  39. leading to→CauseOf→impairing
  40. mutation→CauseOf→causes
  41. mitochondrial mRNA→ThemeOf→leading to
  42. inciting→CauseOf→impairing
  43. impairing→CauseOf→excessive
  44. production of ROS→ThemeOf→MeHg
  45. causes→CauseOf→inciting
  46. mtDNA→ThemeOf→causes
  47. mutation→CauseOf→excessive
  48. mitochondrial mRNA→ThemeOf→mtDNA
  49. MeHg→CauseOf→causes
  50. impairing→CauseOf→leading to
  51. production of ROS→ThemeOf→impairing
  52. causes→CauseOf→impairing
  53. mtDNA→ThemeOf→excessive
  54. mutation→CauseOf→leading to
  55. mitochondrial mRNA→ThemeOf→mutation
  56. MeHg→CauseOf→excessive
  57. impairing→CauseOf→inciting
  58. excessive→CauseOf→causes
  59. mtDNA→ThemeOf→leading to
  60. mutation→ThemeOf→mtDNA
  61. mitochondrial mRNA→ThemeOf→inciting
  62. MeHg→CauseOf→leading to
  63. production of ROS→ThemeOf→causes
361 35052575 7367 The neurotoxic effects include effects in the dopaminergic function in the striatal zone on the brain, where high rates of both oxygen consumption and metabolic rates are crucial factors for increasing brain sensitivity to oxidative damage.. Additionally, alterations in GABA receptor expression are related to anxiety and depression symptoms, which occur in tandem with IBD.
  1. GABA receptor→ThemeOf→alterations
  2. neurotoxic→ThemeOf→age
  3. GABA receptor→ThemeOf→related
  4. expression→ThemeOf→GABA receptor
  5. IBD→ThemeOf→age
  6. age→ThemeOf→expression
  7. age→ThemeOf→IBD
  8. expression→ThemeOf→age
  9. alterations→ThemeOf→GABA receptor
  10. depression symptoms→ThemeOf→age
  11. age→ThemeOf→neurotoxic
  12. alterations→CauseOf→related
  13. GABA receptor→ThemeOf→expression
  14. age→ThemeOf→anxiety
  15. alterations→ThemeOf→age
  16. age→ThemeOf→alterations
  17. age→ThemeOf→depression symptoms
  18. anxiety→ThemeOf→age
  19. age→ThemeOf→related
362 35052575 7393 An important example of these transformations is the methylation of heavy metals, which increases their solubility, and thus the potential transport to the brain.
  1. methylation→CauseOf→increases
363 35052575 7403 Although metals are biologically important, they are usually required in trace amounts, excessive metal accumulation in various organs induces various detrimental intracellular events (oxidative stress, mitochondrial dysfunction, DNA fragmentation, protein misfolding, endoplasmic reticulum (ER) stress, autophagy dysregulation, and the activation of apoptosis).
  1. mitochondrial dysfunction→ThemeOf→autophagy dysregulation
  2. DNA fragmentation→ThemeOf→mitochondrial dysfunction
  3. detrimental intracellular events→ThemeOf→metal
  4. autophagy dysregulation→ThemeOf→activation
  5. mitochondrial dysfunction→ThemeOf→induces
  6. DNA fragmentation→ThemeOf→protein
  7. detrimental intracellular events→ThemeOf→autophagy dysregulation
  8. autophagy dysregulation→ThemeOf→mitochondrial dysfunction
  9. protein→ThemeOf→activation
  10. DNA fragmentation→ThemeOf→detrimental intracellular events
  11. detrimental intracellular events→ThemeOf→induces
  12. autophagy dysregulation→ThemeOf→protein
  13. protein→ThemeOf→mitochondrial dysfunction
  14. DNA fragmentation→ThemeOf→metal
  15. metal→CauseOf→activation
  16. autophagy dysregulation→ThemeOf→DNA fragmentation
  17. activation→ThemeOf→induces
  18. protein→ThemeOf→DNA fragmentation
  19. DNA fragmentation→ThemeOf→autophagy dysregulation
  20. metal→ThemeOf→mitochondrial dysfunction
  21. autophagy dysregulation→ThemeOf→detrimental intracellular events
  22. mitochondrial dysfunction→ThemeOf→activation
  23. protein→ThemeOf→detrimental intracellular events
  24. DNA fragmentation→ThemeOf→induces
  25. metal→ThemeOf→protein
  26. autophagy dysregulation→ThemeOf→metal
  27. mitochondrial dysfunction→ThemeOf→protein
  28. protein→ThemeOf→metal
  29. detrimental intracellular events→ThemeOf→activation
  30. metal→ThemeOf→DNA fragmentation
  31. autophagy dysregulation→ThemeOf→induces
  32. mitochondrial dysfunction→ThemeOf→DNA fragmentation
  33. protein→ThemeOf→autophagy dysregulation
  34. detrimental intracellular events→ThemeOf→mitochondrial dysfunction
  35. metal→ThemeOf→detrimental intracellular events
  36. induces→ThemeOf→activation
  37. mitochondrial dysfunction→ThemeOf→detrimental intracellular events
  38. protein→ThemeOf→induces
  39. detrimental intracellular events→ThemeOf→protein
  40. metal→ThemeOf→autophagy dysregulation
  41. mitochondrial dysfunction→ThemeOf→metal
  42. DNA fragmentation→ThemeOf→activation
  43. detrimental intracellular events→ThemeOf→DNA fragmentation
  44. metal→CauseOf→induces
364 35053920 7426 NSLAB significantly contribute to cheese flavor, texture, nutritional value, and microbial safety in most of the ripened cheese varieties; however, some cheese quality defects and off-flavors, especially in the later phases of ripening, have been attributed to NSLAB.
  1. NSLAB→CauseOf→contribute
  2. cheese flavor→CauseOf→NSLAB
  3. cheese quality defects→CauseOf→NSLAB
  4. NSLAB→CauseOf→cheese quality defects
  5. microbial→CauseOf→NSLAB
  6. NSLAB→CauseOf→microbial
  7. NSLAB→CauseOf→cheese flavor
  8. NSLAB→CauseOf→contribute
  9. microbial→CauseOf→NSLAB
  10. NSLAB→CauseOf→cheese quality defects
  11. cheese quality defects→CauseOf→NSLAB
  12. cheese flavor→CauseOf→NSLAB
  13. NSLAB→CauseOf→microbial
  14. NSLAB→CauseOf→cheese flavor
365 35053920 7497 Residual lactose in the curd is rapidly depleted, mainly by NSLAB, during the early stages of ripening.
  1. NSLAB→CauseOf→depleted
  2. NSLAB→ThemeOf→Residual lactose
  3. Residual lactose→ThemeOf→depleted
  4. Residual lactose→ThemeOf→NSLAB
366 35053920 7508 Citrate, although present at relatively low concentrations in milk (approximately 10 mM), can have a profound impact on cheese aroma.
  1. Citrate→ThemeOf→aroma
  2. Citrate→CauseOf→impact
  3. aroma→ThemeOf→Citrate
  4. aroma→ThemeOf→impact
367 35053920 7512 Although carbon dioxide is responsible for cavity formation in certain cheese types, regarding flavor development, the co-metabolism of citrate and lactose leads to characteristic C4 aroma compounds, such as diacetyl, acetoin, and 2,3-butanediol.
  1. citrate→ThemeOf→diacetyl
  2. citrate→ThemeOf→C4 aroma
  3. acetoin→ThemeOf→citrate
  4. citrate→ThemeOf→acetoin
  5. acetoin→ThemeOf→leads to
  6. diacetyl→ThemeOf→citrate
  7. acetoin→ThemeOf→diacetyl
  8. diacetyl→ThemeOf→leads to
  9. diacetyl→ThemeOf→acetoin
  10. C4 aroma→ThemeOf→citrate
  11. C4 aroma→ThemeOf→leads to
  12. citrate→CauseOf→leads to
368 35053920 7527 Additionally, esterification of hydroxy-fatty acids produces lactones that also contribute to cheese flavor (Figure 4).
  1. esterification→ThemeOf→cheese flavor
  2. cheese flavor→ThemeOf→lactones
  3. cheese flavor→ThemeOf→esterification
  4. cheese flavor→ThemeOf→contribute
  5. lactones→ThemeOf→esterification
  6. lactones→ThemeOf→contribute
  7. lactones→ThemeOf→cheese flavor
  8. esterification→ThemeOf→lactones
  9. esterification→CauseOf→contribute
369 35071941 6643 also reported that Tetragenococcus, Halanaerobium and Lactobacillus were the dominant bacteria in pla-ra from Northeastern Thailand, while Thakur et al., Lindayani et al.
  1. Tetragenococcus→ThemeOf→Lindayani
  2. Lactobacillus→ThemeOf→Lindayani
  3. Lindayani→ThemeOf→Tetragenococcus
  4. Lindayani→ThemeOf→Lactobacillus
370 35071941 6672 who noted that E. faecium EM485 and E. faecium EM 925 had surface hydrophobicity values of 8.18% and 11.33% in the presence of n-hexadecane, respectively.
  1. EM485→ThemeOf→surface hydrophobicity
  2. surface hydrophobicity→ThemeOf→EM485
371 35130830 7829 Further, the Bray-Curtis dissimilarity was lower for the 16S copy number correction (black circles) compared to the raw data (gray circles) in most samples; only in samples S04, S06, S08, and S18 was the Bray-Curtis dissimilarity higher.
  1. S18→ThemeOf→S04
  2. Bray-Curtis dissimilarity→ThemeOf→lower
  3. S06→ThemeOf→Bray-Curtis dissimilarity
  4. S18→ThemeOf→Bray-Curtis dissimilarity
  5. Bray-Curtis dissimilarity→ThemeOf→S08
  6. S06→CauseOf→lower
  7. S18→ThemeOf→Bray-Curtis dissimilarity
  8. Bray-Curtis dissimilarity→ThemeOf→S04
  9. S08→ThemeOf→S18
  10. S18→ThemeOf→S06
  11. Bray-Curtis dissimilarity→ThemeOf→S18
  12. S08→ThemeOf→Bray-Curtis dissimilarity
  13. S18→ThemeOf→lower
  14. Bray-Curtis dissimilarity→ThemeOf→Bray-Curtis dissimilarity
  15. S08→ThemeOf→Bray-Curtis dissimilarity
  16. S18→ThemeOf→S08
  17. Bray-Curtis dissimilarity→ThemeOf→S06
  18. S08→CauseOf→lower
  19. S04→ThemeOf→S18
  20. Bray-Curtis dissimilarity→ThemeOf→S04
  21. Bray-Curtis dissimilarity→ThemeOf→lower
  22. S04→ThemeOf→Bray-Curtis dissimilarity
  23. Bray-Curtis dissimilarity→ThemeOf→S18
  24. Bray-Curtis dissimilarity→ThemeOf→S08
  25. S04→ThemeOf→Bray-Curtis dissimilarity
  26. Bray-Curtis dissimilarity→ThemeOf→Bray-Curtis dissimilarity
  27. S06→ThemeOf→S18
  28. S04→CauseOf→lower
  29. Bray-Curtis dissimilarity→ThemeOf→S06
  30. S06→ThemeOf→Bray-Curtis dissimilarity
372 35130830 7836 The 16S rRNA GCN had only a major influence on the bias for species with a high average number of copies, namely L. delbrueckii (avg.
  1. L. delbrueckii→ThemeOf→bias
  2. bias→ThemeOf→L. delbrueckii
373 35204173 7849 Sprague-Dawley rats were orally administered Bacillus SC06 or SC08 for a 24-day period and thereafter intraperitoneally injected diquat (DQ) to induce oxidative stress.
  1. SC06→ThemeOf→SC08
  2. SC08→ThemeOf→SC06
374 35204173 7850 Results showed that Bacillus, particularly SC06 significantly inhibited hepatic injuries, as evidenced by the alleviated damaged liver structure, the decreased levels of ALT, AST, ALP and LDH, and the suppressed mitochondrial dysfunction.
  1. SC06→ThemeOf→mitochondrial dysfunction
  2. mitochondrial dysfunction→ThemeOf→inhibited
  3. hepatic injuries→ThemeOf→ALP
  4. levels of ALT→ThemeOf→SC06
  5. ALP→ThemeOf→decreased
  6. SC06→ThemeOf→hepatic injuries
  7. mitochondrial dysfunction→ThemeOf→damaged liver
  8. decreased→CauseOf→inhibited
  9. levels of ALT→ThemeOf→mitochondrial dysfunction
  10. ALP→ThemeOf→inhibited
  11. SC06→CauseOf→decreased
  12. mitochondrial dysfunction→ThemeOf→levels of ALT
  13. inhibited→CauseOf→decreased
  14. levels of ALT→ThemeOf→hepatic injuries
  15. ALP→ThemeOf→damaged liver
  16. SC06→CauseOf→inhibited
  17. mitochondrial dysfunction→ThemeOf→ALP
  18. damaged liver→ThemeOf→SC06
  19. levels of ALT→ThemeOf→decreased
  20. ALP→ThemeOf→levels of ALT
  21. SC06→ThemeOf→damaged liver
  22. hepatic injuries→ThemeOf→SC06
  23. damaged liver→ThemeOf→mitochondrial dysfunction
  24. levels of ALT→ThemeOf→inhibited
  25. SC06→ThemeOf→levels of ALT
  26. hepatic injuries→ThemeOf→mitochondrial dysfunction
  27. damaged liver→ThemeOf→hepatic injuries
  28. levels of ALT→ThemeOf→damaged liver
  29. SC06→ThemeOf→ALP
  30. hepatic injuries→ThemeOf→decreased
  31. damaged liver→ThemeOf→decreased
  32. levels of ALT→ThemeOf→ALP
  33. mitochondrial dysfunction→ThemeOf→SC06
  34. hepatic injuries→ThemeOf→inhibited
  35. damaged liver→ThemeOf→inhibited
  36. ALP→ThemeOf→SC06
  37. mitochondrial dysfunction→ThemeOf→hepatic injuries
  38. hepatic injuries→ThemeOf→damaged liver
  39. damaged liver→ThemeOf→levels of ALT
  40. ALP→ThemeOf→mitochondrial dysfunction
  41. mitochondrial dysfunction→ThemeOf→decreased
  42. hepatic injuries→ThemeOf→levels of ALT
  43. damaged liver→ThemeOf→ALP
  44. ALP→ThemeOf→hepatic injuries
375 35204173 7853 The microbial metagenomic analysis demonstrated that Bacillus, particularly SC06 markedly suppress the metabolic pathways such as carbohydrate metabolism, lipid metabolism, amino acid metabolism and metabolism of cofactors and vitamins.
  1. SC06→CauseOf→suppress
376 35204173 7854 Furthermore, SC06 decreased the gene abundance of the pathways mediating bacterial replication, secretion and pathogenicity.
  1. SC06→CauseOf→decreased
377 35204173 7862 It has been reported that in stellate cells, ROS- induced lipid peroxidation activates the inflammation and fibrogenesis, and ultimately causes liver fat accumulation.
  1. liver fat accumulation→ThemeOf→fibrogenesis
  2. causes→CauseOf→activates
  3. inflammation→ThemeOf→ROS-
  4. liver fat accumulation→ThemeOf→causes
  5. ROS-→ThemeOf→liver fat accumulation
  6. liver fat accumulation→ThemeOf→ROS-
  7. ROS-→CauseOf→activates
  8. liver fat accumulation→ThemeOf→inflammation
  9. ROS-→ThemeOf→fibrogenesis
  10. activates→CauseOf→causes
  11. ROS-→CauseOf→causes
  12. fibrogenesis→ThemeOf→liver fat accumulation
  13. ROS-→ThemeOf→inflammation
  14. fibrogenesis→ThemeOf→activates
  15. inflammation→ThemeOf→liver fat accumulation
  16. fibrogenesis→ThemeOf→causes
  17. inflammation→ThemeOf→activates
  18. fibrogenesis→ThemeOf→ROS-
  19. inflammation→ThemeOf→fibrogenesis
  20. liver fat accumulation→ThemeOf→activates
  21. fibrogenesis→ThemeOf→inflammation
  22. inflammation→ThemeOf→causes
378 35204173 7863 Furthermore, ROS generation promotes hepatic insulin resistance, necro-inflammation and finally leads to hepatocyte apoptosis.
  1. necro-inflammation→ThemeOf→promotes
  2. hepatic insulin→ThemeOf→necro-inflammation
  3. leads→CauseOf→promotes
  4. necro-inflammation→ThemeOf→hepatic insulin
  5. hepatic insulin→ThemeOf→hepatocyte
  6. ROS→CauseOf→leads
  7. hepatocyte→ThemeOf→leads
  8. hepatic insulin→ThemeOf→promotes
  9. ROS→ThemeOf→necro-inflammation
  10. hepatocyte→ThemeOf→ROS
  11. ROS→ThemeOf→hepatocyte
  12. hepatocyte→ThemeOf→necro-inflammation
  13. ROS→CauseOf→promotes
  14. hepatocyte→ThemeOf→promotes
  15. ROS→ThemeOf→hepatic insulin
  16. hepatocyte→ThemeOf→hepatic insulin
  17. necro-inflammation→ThemeOf→leads
  18. promotes→CauseOf→leads
  19. necro-inflammation→ThemeOf→ROS
  20. hepatic insulin→ThemeOf→leads
  21. necro-inflammation→ThemeOf→hepatocyte
  22. hepatic insulin→ThemeOf→ROS
379 35204173 7874 Although alteration of gut microbiota has been reported to be a useful integrative treatment of chronic liver diseases, few studies have explored the protective effect of probiotics on oxidative stress-induced liver injuries and the underlying mechanisms remain unknown.
  1. alteration→ThemeOf→liver diseases
  2. alteration→ThemeOf→gut microbiota
  3. gut microbiota→ThemeOf→liver injuries
  4. liver injuries→ThemeOf→liver diseases
  5. gut microbiota→ThemeOf→liver diseases
  6. liver injuries→ThemeOf→alteration
  7. gut microbiota→ThemeOf→alteration
  8. liver injuries→ThemeOf→gut microbiota
  9. liver diseases→ThemeOf→liver injuries
  10. liver diseases→ThemeOf→alteration
  11. liver diseases→ThemeOf→gut microbiota
  12. alteration→ThemeOf→liver injuries
380 35204173 7875 Our previous results showed that Bacillus amyloliquefaciens SC06 and Bacillus licheniformis SC08 could alleviate oxidative stress-induced intestinal disorders and apoptosis.
  1. apoptosis→ThemeOf→SC08
  2. apoptosis→ThemeOf→alleviate
  3. intestinal disorders→ThemeOf→SC06
  4. intestinal disorders→ThemeOf→apoptosis
  5. intestinal disorders→ThemeOf→SC08
  6. SC06→ThemeOf→apoptosis
  7. intestinal disorders→ThemeOf→alleviate
  8. SC06→ThemeOf→intestinal disorders
  9. SC08→ThemeOf→apoptosis
  10. SC06→CauseOf→alleviate
  11. SC08→ThemeOf→intestinal disorders
  12. apoptosis→ThemeOf→SC06
  13. SC08→CauseOf→alleviate
  14. apoptosis→ThemeOf→intestinal disorders
381 35204173 7906 However, SC06 decreased the tissue damages and reversed to the normal histological structure (Figure 1A).
  1. decreased→CauseOf→reversed
  2. SC06→CauseOf→reversed
  3. SC06→CauseOf→decreased
  4. reversed→CauseOf→decreased
382 35204173 7908 SC06 administration significantly lowered the increased LDH level caused by DQ exposure.
  1. DQ exposure→ThemeOf→SC06
  2. LDH level→ThemeOf→SC06
  3. DQ exposure→ThemeOf→LDH level
  4. increased→CauseOf→lowered
  5. SC06→CauseOf→lowered
  6. SC06→ThemeOf→DQ exposure
  7. SC06→CauseOf→increased
  8. SC06→ThemeOf→LDH level
  9. lowered→CauseOf→increased
  10. LDH level→ThemeOf→lowered
  11. DQ exposure→ThemeOf→lowered
  12. LDH level→ThemeOf→DQ exposure
  13. DQ exposure→ThemeOf→increased
  14. LDH level→ThemeOf→increased
383 35204173 7913 SC06 pretreatment could also significantly decreased ROS production (Figure 2B).
  1. SC06→CauseOf→decreased
  2. SC06→ThemeOf→ROS production
  3. ROS production→ThemeOf→SC06
  4. ROS production→ThemeOf→decreased
384 35204173 7915 As shown in Figure 2C, a dramatic DeltaPsim reduction was found in DQ-treated rats (p < 0.01) but was reversed by SC06 pretreatment (p < 0.05).
  1. DeltaPsim reduction→ThemeOf→DQ-treated
  2. DQ-treated→ThemeOf→DeltaPsim reduction
385 35204173 7918 As displayed in Figure 3A, SC06 pretreatment markedly decreased MDA level induced by DQ exposure.
  1. SC06→CauseOf→decreased
386 35204173 7920 Only SC06 pretreatment increased SOD activity.
  1. SC06→CauseOf→increased
387 35204173 7923 Furthermore, SC06 markedly down-regulated the increased expression of NADPH oxidase subunit p47.
  1. SC06→CauseOf→increased
  2. SC06→CauseOf→down-regulated
  3. SC06→ThemeOf→NADPH
  4. down-regulated→CauseOf→increased
  5. increased→CauseOf→down-regulated
  6. NADPH→ThemeOf→increased
  7. expression→ThemeOf→increased
  8. NADPH→ThemeOf→expression
  9. NADPH→ThemeOf→SC06
  10. NADPH→ThemeOf→down-regulated
  11. expression→ThemeOf→NADPH
388 35204173 7925 As shown in the PCoA scatterplot, DQ treatment caused a visible shift from the other groups (Figure 4B).
  1. visible shift→ThemeOf→DQ treatment
  2. DQ treatment→CauseOf→caused
  3. DQ treatment→ThemeOf→visible shift
  4. visible shift→ThemeOf→caused
389 35204173 7930 The f_Bacteroidaceae, g_Bacteroides, s_Blautiaproducta and s_Alistipesindistinctus showed large effect sizes in SC08 + DQ group.
  1. g_Bacteroides→ThemeOf→s_Alistipesindistinctus
  2. s_Alistipesindistinctus→ThemeOf→f_Bacteroidaceae
  3. s_Alistipesindistinctus→ThemeOf→g_Bacteroides
  4. f_Bacteroidaceae→ThemeOf→s_Alistipesindistinctus
390 35204173 7932 Compared to the DQ group, SC06 pretreatment significantly upregulated the levels of g_Anaerofilum and s_Bacteroides uniformis, and downregulated s_Oscillospira guilliermondil (p < 0.05).
  1. s_Bacteroides→ThemeOf→SC06
  2. s_Oscillospira→ThemeOf→downregulated
  3. s_Bacteroides→ThemeOf→downregulated
  4. s_Oscillospira→ThemeOf→upregulated
  5. s_Bacteroides→ThemeOf→upregulated
  6. s_Oscillospira→ThemeOf→levels of g_Anaerofilum and
  7. SC06→CauseOf→downregulated
  8. s_Bacteroides→ThemeOf→levels of g_Anaerofilum and
  9. SC06→CauseOf→upregulated
  10. levels of g_Anaerofilum and→ThemeOf→SC06
  11. SC06→ThemeOf→s_Bacteroides
  12. levels of g_Anaerofilum and→ThemeOf→downregulated
  13. SC06→ThemeOf→levels of g_Anaerofilum and
  14. levels of g_Anaerofilum and→ThemeOf→upregulated
  15. SC06→ThemeOf→s_Oscillospira
  16. levels of g_Anaerofilum and→ThemeOf→s_Bacteroides
  17. downregulated→CauseOf→upregulated
  18. levels of g_Anaerofilum and→ThemeOf→s_Oscillospira
  19. upregulated→CauseOf→downregulated
  20. s_Oscillospira→ThemeOf→SC06
391 35204173 7933 SC08 pretreatment markedly increased the richness of g_Helicobacter (p < 0.05).
  1. richness→ThemeOf→g_Helicobacter
  2. richness→ThemeOf→increased
  3. SC08→ThemeOf→g_Helicobacter
  4. SC08→ThemeOf→richness
  5. SC08→CauseOf→increased
  6. g_Helicobacter→ThemeOf→SC08
  7. g_Helicobacter→ThemeOf→richness
  8. g_Helicobacter→ThemeOf→increased
  9. richness→ThemeOf→SC08
392 35204173 7943 At the first level of KEGG pathways, DQ exposure showed a marked increase in the function of gut microbial metabolism while Bacillus pretreatments, particularly SC06 down-regulated the increased trend (data not shown).
  1. increase→CauseOf→down-regulated
  2. down-regulated→CauseOf→increase
  3. SC06→ThemeOf→function
  4. gut microbial metabolism→ThemeOf→SC06
  5. SC06→CauseOf→increase
  6. gut microbial metabolism→ThemeOf→function
  7. SC06→CauseOf→down-regulated
  8. gut microbial metabolism→ThemeOf→increase
  9. SC06→ThemeOf→gut microbial metabolism
  10. gut microbial metabolism→ThemeOf→down-regulated
  11. function→ThemeOf→SC06
  12. function→ThemeOf→increase
  13. function→ThemeOf→down-regulated
  14. function→ThemeOf→gut microbial metabolism
393 35204173 7944 Results from the KEGG second level involving metabolism showed that DQ exposure activated all the metabolic pathways, whereas Bacillus administrations could reverse this trend.
  1. DQ exposure→CauseOf→activated
394 35204173 7950 Specifically, SC06 dramatically reduced the genes involving in Lysine degradation, Tyrosine metabolism, Phenylalanine metabolism, Tryptophan metabolism and D-alanine metabolism (p < 0.01).
  1. Lysine degradation→ThemeOf→reduced
  2. Tryptophan metabolism→ThemeOf→SC06
  3. Tyrosine metabolism→ThemeOf→Phenylalanine metabolism
  4. Phenylalanine metabolism→ThemeOf→Tyrosine metabolism
  5. Lysine degradation→ThemeOf→D-alanine metabolism
  6. Tryptophan metabolism→ThemeOf→Tyrosine metabolism
  7. D-alanine metabolism→ThemeOf→Lysine degradation
  8. Phenylalanine metabolism→ThemeOf→reduced
  9. Lysine degradation→ThemeOf→Phenylalanine metabolism
  10. Tryptophan metabolism→ThemeOf→reduced
  11. D-alanine metabolism→ThemeOf→SC06
  12. Phenylalanine metabolism→ThemeOf→D-alanine metabolism
  13. SC06→ThemeOf→Lysine degradation
  14. Tryptophan metabolism→ThemeOf→D-alanine metabolism
  15. D-alanine metabolism→ThemeOf→Tryptophan metabolism
  16. SC06→ThemeOf→Tryptophan metabolism
  17. Tryptophan metabolism→ThemeOf→Phenylalanine metabolism
  18. D-alanine metabolism→ThemeOf→Tyrosine metabolism
  19. SC06→ThemeOf→Tyrosine metabolism
  20. Tyrosine metabolism→ThemeOf→Lysine degradation
  21. D-alanine metabolism→ThemeOf→reduced
  22. SC06→CauseOf→reduced
  23. Tyrosine metabolism→ThemeOf→SC06
  24. D-alanine metabolism→ThemeOf→Phenylalanine metabolism
  25. Lysine degradation→ThemeOf→SC06
  26. SC06→ThemeOf→D-alanine metabolism
  27. Tyrosine metabolism→ThemeOf→Tryptophan metabolism
  28. Phenylalanine metabolism→ThemeOf→Lysine degradation
  29. Lysine degradation→ThemeOf→Tryptophan metabolism
  30. SC06→ThemeOf→Phenylalanine metabolism
  31. Tyrosine metabolism→ThemeOf→reduced
  32. Phenylalanine metabolism→ThemeOf→SC06
  33. Lysine degradation→ThemeOf→Tyrosine metabolism
  34. Tryptophan metabolism→ThemeOf→Lysine degradation
  35. Tyrosine metabolism→ThemeOf→D-alanine metabolism
  36. Phenylalanine metabolism→ThemeOf→Tryptophan metabolism
395 35204173 7953 As displayed in Figure 10, DQ significantly increased the KEGG pathways at the first level, i.e., cellular processes, human diseases, genetic information and environmental information, whereas Bacillus pretreatments, particularly SC06 could reverse this trend.
  1. SC06→CauseOf→increased
396 35204173 7958 The current study revealed the antioxidant functions of two Bacillus species, B. amyloliquefaciens SC06 and B. licheniformis SC08 in preventing liver injuries.
  1. liver injuries→ThemeOf→SC06
  2. liver injuries→ThemeOf→preventing
  3. liver injuries→ThemeOf→antioxidant
  4. antioxidant→ThemeOf→SC06
  5. antioxidant→ThemeOf→liver injuries
  6. antioxidant→ThemeOf→preventing
  7. SC06→ThemeOf→liver injuries
  8. SC06→CauseOf→preventing
  9. SC06→ThemeOf→antioxidant
397 35204173 7960 For instance, Bacillus spores protected against acetaminophen-induced acute liver injury in rats.
  1. acute liver injury→ThemeOf→protected
  2. acute liver injury→ThemeOf→acetaminophen-induced
  3. acetaminophen-induced→ThemeOf→Bacillus
  4. acetaminophen-induced→ThemeOf→acute liver injury
  5. acetaminophen-induced→ThemeOf→protected
  6. Bacillus→ThemeOf→acute liver injury
  7. Bacillus→CauseOf→protected
  8. Bacillus→ThemeOf→acetaminophen-induced
  9. acute liver injury→ThemeOf→Bacillus
398 35204173 7964 Whether Bacillus SC06 or SC08 modulates the functions of stellate cells to alleviate oxidative stress warrants further investigation.
  1. functions of stellate cells→ThemeOf→modulates
  2. functions of stellate cells→ThemeOf→alleviate oxidative stress
  3. SC08→ThemeOf→functions of stellate cells
  4. SC08→CauseOf→modulates
  5. SC08→ThemeOf→alleviate oxidative stress
  6. SC06→ThemeOf→functions of stellate cells
  7. alleviate oxidative stress→ThemeOf→SC06
  8. SC06→CauseOf→modulates
  9. alleviate oxidative stress→ThemeOf→functions of stellate cells
  10. SC06→ThemeOf→alleviate oxidative stress
  11. alleviate oxidative stress→ThemeOf→SC08
  12. functions of stellate cells→ThemeOf→SC06
  13. alleviate oxidative stress→ThemeOf→modulates
  14. functions of stellate cells→ThemeOf→SC08
399 35204173 7965 We also found that Bacillus SC06 showed stronger antioxidant capacity than SC08, as evidenced by the ameliorated hepatic injuries, decreased mitochondrial dysfunction and enhanced antioxidant levels under DQ exposure.
  1. antioxidant→ThemeOf→enhanced
  2. antioxidant levels→ThemeOf→stronger
  3. SC06→ThemeOf→antioxidant levels
  4. decreased mitochondrial dysfunction→ThemeOf→stronger
  5. antioxidant→ThemeOf→antioxidant levels
  6. antioxidant levels→ThemeOf→decreased mitochondrial dysfunction
  7. SC06→ThemeOf→hepatic injuries
  8. antioxidant→ThemeOf→hepatic injuries
  9. hepatic injuries→ThemeOf→enhanced
  10. SC06→CauseOf→stronger
  11. antioxidant→ThemeOf→SC06
  12. hepatic injuries→ThemeOf→antioxidant
  13. SC06→ThemeOf→decreased mitochondrial dysfunction
  14. antioxidant→ThemeOf→stronger
  15. hepatic injuries→ThemeOf→antioxidant levels
  16. stronger→CauseOf→enhanced
  17. antioxidant→ThemeOf→decreased mitochondrial dysfunction
  18. hepatic injuries→ThemeOf→SC06
  19. decreased mitochondrial dysfunction→ThemeOf→enhanced
  20. antioxidant levels→ThemeOf→enhanced
  21. hepatic injuries→ThemeOf→stronger
  22. decreased mitochondrial dysfunction→ThemeOf→antioxidant
  23. antioxidant levels→ThemeOf→antioxidant
  24. hepatic injuries→ThemeOf→decreased mitochondrial dysfunction
  25. decreased mitochondrial dysfunction→ThemeOf→antioxidant levels
  26. antioxidant levels→ThemeOf→hepatic injuries
  27. SC06→CauseOf→enhanced
  28. decreased mitochondrial dysfunction→ThemeOf→hepatic injuries
  29. enhanced→CauseOf→stronger
  30. antioxidant levels→ThemeOf→SC06
  31. SC06→ThemeOf→antioxidant
  32. decreased mitochondrial dysfunction→ThemeOf→SC06
400 35204173 7969 On the contrary, another report revealed that SIRT4 modulation of fatty acid metabolism reduced the levels of free fatty acids but unfortunately increased ROS production in obese patients with NAFLD.
  1. ROS production→ThemeOf→increased
  2. SIRT4→ThemeOf→obese
  3. obese→ThemeOf→increased
  4. levels of free fatty acids→ThemeOf→reduced
  5. ROS production→ThemeOf→SIRT4
  6. modulation→ThemeOf→levels of free fatty acids
  7. obese→ThemeOf→SIRT4
  8. levels of free fatty acids→ThemeOf→ROS production
  9. ROS production→ThemeOf→modulation
  10. modulation→CauseOf→reduced
  11. obese→ThemeOf→modulation
  12. levels of free fatty acids→ThemeOf→increased
  13. ROS production→ThemeOf→obese
  14. modulation→ThemeOf→ROS production
  15. levels of free fatty acids→ThemeOf→SIRT4
  16. increased→CauseOf→reduced
  17. modulation→CauseOf→increased
  18. levels of free fatty acids→ThemeOf→modulation
  19. SIRT4→ThemeOf→levels of free fatty acids
  20. modulation→ThemeOf→SIRT4
  21. levels of free fatty acids→ThemeOf→obese
  22. SIRT4→ThemeOf→reduced
  23. modulation→ThemeOf→obese
  24. reduced→CauseOf→increased
  25. SIRT4→ThemeOf→ROS production
  26. obese→ThemeOf→levels of free fatty acids
  27. ROS production→ThemeOf→levels of free fatty acids
  28. SIRT4→ThemeOf→increased
  29. obese→ThemeOf→reduced
  30. ROS production→ThemeOf→reduced
  31. SIRT4→ThemeOf→modulation
  32. obese→ThemeOf→ROS production
401 35204173 7970 In our study, Bacillus SC06 significantly decreased the mitochondrial dysfunction in DQ-exposed rats, but whether SIRT4 participated in this process was not investigated.
  1. Bacillus→CauseOf→decreased
  2. Bacillus→ThemeOf→mitochondrial dysfunction
  3. mitochondrial dysfunction→ThemeOf→Bacillus
  4. mitochondrial dysfunction→ThemeOf→decreased
  5. mitochondrial dysfunction→ThemeOf→SC06
  6. SC06→CauseOf→decreased
  7. SC06→ThemeOf→mitochondrial dysfunction
402 35204173 7971 Nevertheless, another study in our lab showed that SC06 could activate SIRT1/FOXO3 signaling to alleviate oxidative stress in IPEC-J2 cells.
  1. FOXO3→ThemeOf→SC06
  2. activate→CauseOf→alleviate
  3. FOXO3→ThemeOf→activate
  4. alleviate→CauseOf→activate
  5. FOXO3→ThemeOf→alleviate
  6. SC06→ThemeOf→FOXO3
  7. SC06→ThemeOf→SIRT1
  8. SC06→CauseOf→activate
  9. SC06→CauseOf→alleviate
  10. SIRT1→ThemeOf→SC06
  11. SIRT1→ThemeOf→activate
  12. SIRT1→ThemeOf→alleviate
403 35204173 7974 By using 16S rRNA sequencing analysis, we demonstrated that Bacillus SC06 protected the liver against oxidative stress by altering gut microbiota.
  1. gut microbiota→ThemeOf→protected
  2. altering→CauseOf→protected
  3. SC06→ThemeOf→gut microbiota
  4. protected→CauseOf→altering
  5. Bacillus→ThemeOf→gut microbiota
  6. SC06→ThemeOf→liver against oxidative stress
  7. Bacillus→ThemeOf→liver against oxidative stress
  8. SC06→CauseOf→altering
  9. Bacillus→CauseOf→altering
  10. SC06→CauseOf→protected
  11. Bacillus→CauseOf→protected
  12. liver against oxidative stress→ThemeOf→Bacillus
  13. gut microbiota→ThemeOf→Bacillus
  14. liver against oxidative stress→ThemeOf→gut microbiota
  15. gut microbiota→ThemeOf→SC06
  16. liver against oxidative stress→ThemeOf→SC06
  17. gut microbiota→ThemeOf→liver against oxidative stress
  18. liver against oxidative stress→ThemeOf→altering
  19. gut microbiota→ThemeOf→altering
  20. liver against oxidative stress→ThemeOf→protected
404 35204173 7975 Evidence suggested that modulation of gut microbiota have the potential to control hepatic cellular stress and treat liver diseases of different etiologies.
  1. hepatic cellular stress→ThemeOf→modulation
  2. modulation→ThemeOf→gut microbiota
  3. hepatic cellular stress→ThemeOf→treat
  4. modulation→CauseOf→control
  5. liver diseases→ThemeOf→hepatic cellular stress
  6. gut microbiota→ThemeOf→liver diseases
  7. modulation→CauseOf→treat
  8. liver diseases→ThemeOf→gut microbiota
  9. gut microbiota→ThemeOf→hepatic cellular stress
  10. treat→CauseOf→control
  11. liver diseases→ThemeOf→control
  12. gut microbiota→ThemeOf→control
  13. liver diseases→ThemeOf→modulation
  14. gut microbiota→ThemeOf→modulation
  15. liver diseases→ThemeOf→treat
  16. gut microbiota→ThemeOf→treat
  17. hepatic cellular stress→ThemeOf→liver diseases
  18. control→CauseOf→treat
  19. hepatic cellular stress→ThemeOf→gut microbiota
  20. modulation→ThemeOf→liver diseases
  21. hepatic cellular stress→ThemeOf→control
  22. modulation→ThemeOf→hepatic cellular stress
405 35204173 7986 Compared to the DQ group, SC06 pretreatment markedly upregulated the richness of g_Anaerofilum, s_Bacteroides uniformis and downregulated s_Oscillospira guilliermondii.
  1. SC06→ThemeOf→richness
  2. richness→ThemeOf→upregulated
  3. SC06→CauseOf→upregulated
  4. richness→ThemeOf→downregulated
  5. SC06→CauseOf→downregulated
  6. upregulated→CauseOf→downregulated
  7. s_Oscillospira→ThemeOf→SC06
  8. downregulated→CauseOf→upregulated
  9. s_Bacteroides→ThemeOf→SC06
  10. s_Oscillospira→ThemeOf→richness
  11. s_Bacteroides→ThemeOf→richness
  12. s_Oscillospira→ThemeOf→upregulated
  13. s_Bacteroides→ThemeOf→upregulated
  14. s_Oscillospira→ThemeOf→downregulated
  15. s_Bacteroides→ThemeOf→downregulated
  16. richness→ThemeOf→s_Bacteroides
  17. SC06→ThemeOf→s_Bacteroides
  18. richness→ThemeOf→SC06
  19. SC06→ThemeOf→s_Oscillospira
  20. richness→ThemeOf→s_Oscillospira
406 35204173 7991 Therefore, our findings suggest that SC06 could optimize the composition of gut microbiota and restore the gut dysbiosis induced by DQ exposure.
  1. composition of gut microbiota→ThemeOf→optimize
  2. composition of gut microbiota→ThemeOf→SC06
  3. restore→CauseOf→optimize
  4. optimize→CauseOf→restore
  5. SC06→ThemeOf→composition of gut microbiota
  6. SC06→CauseOf→restore
  7. SC06→CauseOf→optimize
  8. composition of gut microbiota→ThemeOf→restore
407 35204173 7992 Co-occurrence networks provide insight into microbial interactions, and we found that the average degree and graph density of microbial network in Bacillus groups were higher than those of the other groups, suggesting that Bacillus pretreatments increased microbe connections.
  1. microbe→ThemeOf→higher
  2. higher→CauseOf→increased
  3. Bacillus→CauseOf→microbe
  4. Bacillus→CauseOf→increased
  5. Bacillus→CauseOf→graph density
  6. Bacillus→CauseOf→higher
  7. increased→CauseOf→higher
  8. microbe→CauseOf→Bacillus
  9. graph density→CauseOf→Bacillus
  10. microbe→ThemeOf→increased
408 35204173 7994 Results of Pearson's correlation showed that the beneficial microbes such as Lactobacillus, Faecalibacterium and Butyricicoccus exhibited a negative correlation with MDA, whereas g_Escherichia and g_Shigella were positively correlated with ALT and AST, which further confirmed that the alteration of microbiota composition was related to attenuating oxidative stress-induced liver injuries.
  1. g_Escherichia→CauseOf→attenuating
  2. MDA→ThemeOf→liver injuries
  3. MDA→ThemeOf→attenuating
  4. MDA→ThemeOf→g_Escherichia
  5. liver injuries→ThemeOf→MDA
  6. liver injuries→ThemeOf→attenuating
  7. liver injuries→ThemeOf→g_Escherichia
  8. g_Escherichia→ThemeOf→MDA
  9. g_Escherichia→ThemeOf→liver injuries
409 35204173 7995 The functional KEGG annotation analyses of metagenomic study indicated that Bacillus administration, particularly SC06 could inhibit the microbial metabolic pathways including carbohydrate metabolism, lipid metabolism, amino acid metabolism and metabolism of cofactors and vitamins).
  1. SC06→CauseOf→inhibit
410 35204173 7996 SC06 pretreatment markedly decreased the gene enrichment of carbohydrates such as galactose metabolism.
  1. SC06→CauseOf→decreased
411 35204173 8000 Moreover, SC06 could decrease amino acid metabolism, particularly for phenylalanine and tryptophan.
  1. amino acid metabolism→ThemeOf→decrease
  2. amino acid metabolism→ThemeOf→SC06
  3. SC06→CauseOf→decrease
  4. SC06→ThemeOf→amino acid metabolism
412 35204173 8006 Studies also found that tryptophan takes an important part in the biofilm formation of pathogens such as Salmonella Typhimurium; deletion of tryptophan genes led to the decreased bacterial attachment and biofilm defect.
  1. biofilm defect→ThemeOf→decreased
  2. tryptophan→ThemeOf→bacterial attachment
  3. biofilm defect→ThemeOf→bacterial attachment
  4. tryptophan→ThemeOf→deletion
  5. biofilm defect→ThemeOf→tryptophan
  6. deletion→CauseOf→decreased
  7. biofilm defect→ThemeOf→deletion
  8. deletion→ThemeOf→biofilm defect
  9. bacterial attachment→ThemeOf→decreased
  10. deletion→ThemeOf→bacterial attachment
  11. bacterial attachment→ThemeOf→biofilm defect
  12. deletion→ThemeOf→tryptophan
  13. bacterial attachment→ThemeOf→tryptophan
  14. bacterial attachment→ThemeOf→deletion
  15. tryptophan→ThemeOf→decreased
  16. tryptophan→ThemeOf→biofilm defect
413 35204173 8010 For instance, Van De Lagemaat found that B Vitamins scavenge reactive oxygen species and modulate immune cytokines to reduce oxidative stress; supplementation with B vitamins enhanced the anti-oxidative state in patients with liver cancer.
  1. supplementation→CauseOf→enhanced
414 35204173 8015 SC06 significantly decreased the gene enrichment involved in cellular processes such as bacterial chemotaxis, flagellar assembly and biofilm formation.
  1. gene enrichment→ThemeOf→decreased
  2. gene enrichment→ThemeOf→SC06
  3. SC06→CauseOf→decreased
  4. SC06→ThemeOf→gene enrichment
415 35204173 8021 In our study, SC06 significantly downregulated the expression of the key genes involved in the pathways for bacterial chemotaxis, flagella assembly and biofilm formation, suggesting its potential ability to inhibit pathogen growth and colonization.
  1. SC06→CauseOf→downregulated
  2. SC06→CauseOf→inhibit
  3. inhibit→CauseOf→downregulated
  4. downregulated→CauseOf→inhibit
416 35204173 8022 Results also revealed that SC06 pretreatment decreased the gene enrichment of bacterial secretion systems.
  1. SC06→CauseOf→decreased
417 35204173 8024 These results confirmed SC06 administration downregulated the pathways associated with the pathogenicity of opportunistic pathogens, and exerted a protective role in alleviating oxidative stress- induced microbiota imbalance.
  1. SC06→CauseOf→downregulated
418 35204173 8025 In conclusion, Bacillus SC06 alleviated oxidative stress-induced live injuries via modulating the composition, and pathways for metabolism and bacterial replication and secretion of gut microbiota.
  1. oxidative stress-induced→ThemeOf→alleviated
  2. Bacillus→CauseOf→alleviated
  3. oxidative stress-induced→ThemeOf→modulating
  4. Bacillus→CauseOf→modulating
  5. SC06→ThemeOf→oxidative stress-induced
  6. SC06→ThemeOf→composition
  7. composition→ThemeOf→SC06
  8. composition→ThemeOf→Bacillus
  9. alleviated→CauseOf→modulating
  10. SC06→CauseOf→alleviated
  11. modulating→CauseOf→alleviated
  12. oxidative stress-induced→ThemeOf→SC06
  13. SC06→CauseOf→modulating
  14. composition→ThemeOf→alleviated
  15. oxidative stress-induced→ThemeOf→Bacillus
  16. Bacillus→ThemeOf→oxidative stress-induced
  17. composition→ThemeOf→modulating
  18. Bacillus→ThemeOf→composition
419 35265049 8044 The total organic carbon (%TOC) was dosed by organic matter oxidation using K2Cr2O7 according to.
  1. organic matter oxidation→ThemeOf→K2Cr2O7
  2. K2Cr2O7→ThemeOf→total organic carbon
  3. K2Cr2O7→ThemeOf→organic matter oxidation
  4. total organic carbon→ThemeOf→organic matter oxidation
  5. total organic carbon→ThemeOf→K2Cr2O7
  6. organic matter oxidation→ThemeOf→total organic carbon
420 35265049 8072 In the initial mixture (Figure 3C), the fungal microbiome was dominated by four species (> 5%), namely, Dipodascus australiensis (33.18%), Penicillium roqueforti (27.27%), Pichia sp.
  1. Penicillium→ThemeOf→Pichia
  2. Penicillium→ThemeOf→fungal microbiome
  3. fungal microbiome→ThemeOf→Dipodascus australiensis
  4. Dipodascus australiensis→ThemeOf→Pichia
  5. fungal microbiome→ThemeOf→Pichia
  6. Dipodascus australiensis→ThemeOf→Penicillium
  7. fungal microbiome→ThemeOf→Penicillium
  8. Dipodascus australiensis→ThemeOf→fungal microbiome
  9. Pichia→ThemeOf→Dipodascus australiensis
  10. Pichia→ThemeOf→Penicillium
  11. Pichia→ThemeOf→fungal microbiome
  12. Penicillium→ThemeOf→Dipodascus australiensis
421 35265049 8074 Similarly, the bacterial microbiome (Figure 3D) was dominated by Psychrobacter aquaticus (30.3%), Corynebacterium variabile (28.7%), Carnobacterium maltaromaticum (11.5%), and Psychrobacter pulmonis (9.7%).
  1. Carnobacterium→ThemeOf→Psychrobacter pulmonis
  2. Carnobacterium→ThemeOf→bacterial
  3. Carnobacterium→ThemeOf→Psychrobacter aquaticus
  4. bacterial→ThemeOf→Corynebacterium variabile
  5. bacterial→ThemeOf→Psychrobacter pulmonis
  6. Corynebacterium variabile→ThemeOf→Carnobacterium
  7. bacterial→ThemeOf→Carnobacterium
  8. Corynebacterium variabile→ThemeOf→bacterial
  9. bacterial→ThemeOf→Psychrobacter aquaticus
  10. Psychrobacter pulmonis→ThemeOf→Carnobacterium
  11. Psychrobacter aquaticus→ThemeOf→Carnobacterium
  12. Psychrobacter pulmonis→ThemeOf→bacterial
  13. Psychrobacter aquaticus→ThemeOf→bacterial
  14. Carnobacterium→ThemeOf→Corynebacterium variabile
422 35265049 8075 By the end of thermophilic phase, major changes were observed in taxa abundancy (Figure 3C), as the compost was dominated by only two fungal and three bacterial species, namely, Candida freyschussii (87.3%), Sporopachydermia lactativora (10.6%), Pseudomonas syringae (47.8%), Actinobacter sp.
  1. Pseudomonas syringae→ThemeOf→Sporopachydermia
  2. Actinobacter→ThemeOf→taxa
  3. Actinobacter→ThemeOf→Sporopachydermia
  4. taxa→ThemeOf→Pseudomonas syringae
  5. taxa→ThemeOf→Actinobacter
  6. taxa→ThemeOf→Sporopachydermia
  7. Sporopachydermia→ThemeOf→Pseudomonas syringae
  8. Sporopachydermia→ThemeOf→Actinobacter
  9. Sporopachydermia→ThemeOf→taxa
  10. Pseudomonas syringae→ThemeOf→taxa
423 35265049 8081 (7.1%), Brevibacterium linens (7%) and Arthrobacter protophormiae (5.3%), followed by Isoptericola sp.
  1. Isoptericola→ThemeOf→Arthrobacter
  2. Brevibacterium→ThemeOf→Isoptericola
  3. Arthrobacter→ThemeOf→Isoptericola
  4. Isoptericola→ThemeOf→Brevibacterium
424 35295308 8137 Particularly large numbers of G2Is were found in the family Phormidiaceae, which includes Arthrospira platensis.
  1. G2Is→CauseOf→found
425 35335231 8154 Comparative Genomic Analysis Reveals Intestinal Habitat Adaptation of Ligilactobacillus equi Rich in Prophage and Degrading Cellulase Ligilactobacillus equi is common in the horse intestine, alleviates the infection of Salmonella, and regulates intestinal flora.
  1. regulates→CauseOf→alleviates
  2. infection→ThemeOf→Ligilactobacillus
  3. intestinal flora→ThemeOf→Salmonella
  4. Ligilactobacillus→ThemeOf→Salmonella
  5. infection→ThemeOf→alleviates
  6. intestinal flora→ThemeOf→regulates
  7. Ligilactobacillus→ThemeOf→regulates
  8. infection→ThemeOf→Degrading
  9. intestinal flora→ThemeOf→Ligilactobacillus
  10. Ligilactobacillus→ThemeOf→alleviates
  11. infection→ThemeOf→intestinal flora
  12. intestinal flora→ThemeOf→alleviates
  13. Salmonella→ThemeOf→regulates
  14. Ligilactobacillus→ThemeOf→infection
  15. Degrading→ThemeOf→Salmonella
  16. intestinal flora→ThemeOf→infection
  17. Salmonella→ThemeOf→Ligilactobacillus
  18. Ligilactobacillus→ThemeOf→Degrading
  19. Degrading→CauseOf→regulates
  20. intestinal flora→ThemeOf→Degrading
  21. Salmonella→ThemeOf→alleviates
  22. Ligilactobacillus→ThemeOf→intestinal flora
  23. Degrading→ThemeOf→Ligilactobacillus
  24. Salmonella→ThemeOf→infection
  25. alleviates→CauseOf→regulates
  26. Degrading→CauseOf→alleviates
  27. Salmonella→ThemeOf→Degrading
  28. infection→ThemeOf→Salmonella
  29. Degrading→ThemeOf→infection
  30. Salmonella→ThemeOf→intestinal flora
  31. infection→ThemeOf→regulates
  32. Degrading→ThemeOf→intestinal flora
426 35335231 8167 One study of strains from horse feces samples showed that all samples contained Ligilactobacillus hayakitensis, Limosilactobacillus equigenerosi, and L. equi.
  1. Ligilactobacillus→CauseOf→contained
  2. Ligilactobacillus→ThemeOf→Limosilactobacillus equigenerosi
  3. Limosilactobacillus equigenerosi→ThemeOf→contained
  4. Limosilactobacillus equigenerosi→ThemeOf→Ligilactobacillus
427 35335231 8179 Among the four strains of L. equi, strain IMAU81196 had the smallest genome (1.95 Mbp) and the largest GC content (39.5%).
  1. GC content→ThemeOf→smallest
  2. GC content→ThemeOf→IMAU81196
  3. IMAU81196→ThemeOf→GC content
  4. IMAU81196→CauseOf→smallest
428 35335231 8198 The ANI value of IMAU81196 and DPC 6820 was 98.44%, which was the highest of all strains, indicating that the base and nucleic acid match between IMAU81196 and DPC 6820 was higher.
  1. IMAU81196→CauseOf→higher
  2. IMAU81196→ThemeOf→base
  3. base→ThemeOf→IMAU81196
  4. base→ThemeOf→higher
429 35335231 8199 The ANI value of strains JCM 10991T and DSM 15833T was 99.95%, indicating that there are differences between the homologous gene regions of these two strains.
  1. DSM 15833T→ThemeOf→ANI
  2. JCM 10991T→ThemeOf→ANI
  3. ANI→ThemeOf→DSM 15833T
  4. ANI→ThemeOf→JCM 10991T
430 35335231 8205 From the perspective of the phylogenetic tree, the evolutionary divergence time between L. equi IMAU81196 and L. equi DPC 6820 is shorter, and the genetic relationship is closer.
  1. evolutionary divergence→ThemeOf→shorter
  2. evolutionary divergence→ThemeOf→DPC 6820
  3. DPC 6820→ThemeOf→evolutionary divergence
  4. DPC 6820→CauseOf→shorter
431 35335231 8206 The results showed that a mean of 747 protein-coding genes was annotated in the four strains of L. equi, among which L. equi JCM 10991T had the most genes (828), and the remaining three strains had about 720 genes.
  1. L. equi JCM 10991T→ThemeOf→L. equi
  2. L. equi→ThemeOf→L. equi JCM 10991T
432 35335231 8213 The fewest carbohydrate genes were found in L. equi DPC 6820 (85 genes representing 11.92% of all genes).
  1. DPC 6820→CauseOf→fewest
433 35335231 8214 It can be seen from the figure that DSM 15833T has fewer genes than JCM 10991T in each gene category, and there are obvious differences in nucleosides, nucleotides, and membrane transport.
  1. DSM 15833T→ThemeOf→membrane transport
  2. DSM 15833T→CauseOf→fewer
  3. nucleosides→ThemeOf→DSM 15833T
  4. nucleosides→ThemeOf→membrane transport
  5. nucleosides→ThemeOf→fewer
  6. membrane transport→ThemeOf→DSM 15833T
  7. membrane transport→ThemeOf→nucleosides
  8. membrane transport→ThemeOf→fewer
  9. DSM 15833T→ThemeOf→nucleosides
434 35335231 8227 IMAU81196 unique genes were mainly involved in the metabolism of carbohydrates.
  1. metabolism of carbohydrates→ThemeOf→IMAU81196
  2. metabolism of carbohydrates→ThemeOf→involved
  3. IMAU81196→ThemeOf→metabolism of carbohydrates
  4. IMAU81196→CauseOf→involved
435 35335231 8249 This is a diverse family, transferring sugar from UDP-glucose, UDP-N-acetyl-galactosamine, GDP-mannose, or CDP-abequose to a range of substrates, including cellulose, dolichol phosphate, and teichoic acids.
  1. UDP-glucose→ThemeOf→dolichol phosphate
  2. sugar→ThemeOf→transferring
  3. sugar→ThemeOf→dolichol phosphate
  4. sugar→ThemeOf→UDP-glucose
  5. dolichol phosphate→ThemeOf→transferring
  6. dolichol phosphate→ThemeOf→sugar
  7. dolichol phosphate→ThemeOf→UDP-glucose
  8. UDP-glucose→CauseOf→transferring
  9. UDP-glucose→ThemeOf→sugar
436 35347213 8316 These ARGs were the following: aadA2, ant(6)-Ia, ant(9)-Ia, aph(3')-IIa, aph(3')-IIIa, dfrG, erm(44)v, lmrD, lsaE, poxtA, qnrD1, qnrS1, sul1, sul2, tet(K), vatE (Fig.
  1. lmrD→ThemeOf→sul1
  2. aadA2→ThemeOf→sul2
  3. sul2→ThemeOf→lmrD
  4. qnrS1→ThemeOf→lmrD
  5. lmrD→ThemeOf→aadA2
  6. aph→CauseOf→qnrS1
  7. sul2→ThemeOf→aadA2
  8. qnrS1→ThemeOf→aadA2
  9. lmrD→CauseOf→aph
  10. aph→CauseOf→sul1
  11. sul2→CauseOf→aph
  12. qnrS1→CauseOf→aph
  13. lmrD→ThemeOf→qnrD1
  14. aph→CauseOf→lmrD
  15. sul2→CauseOf→aph
  16. qnrS1→CauseOf→aph
  17. lmrD→ThemeOf→sul2
  18. aph→CauseOf→qnrD1
  19. aph→CauseOf→qnrS1
  20. sul1→ThemeOf→lmrD
  21. lmrD→CauseOf→aph
  22. aph→CauseOf→sul2
  23. aph→CauseOf→sul1
  24. sul1→ThemeOf→aadA2
  25. aadA2→ThemeOf→qnrS1
  26. qnrD1→ThemeOf→lmrD
  27. aph→CauseOf→lmrD
  28. sul1→CauseOf→aph
  29. aadA2→ThemeOf→sul1
  30. qnrD1→ThemeOf→aadA2
  31. aph→CauseOf→qnrD1
  32. sul1→CauseOf→aph
  33. aadA2→ThemeOf→lmrD
  34. qnrD1→CauseOf→aph
  35. aph→CauseOf→sul2
  36. lmrD→ThemeOf→qnrS1
  37. aadA2→ThemeOf→qnrD1
  38. qnrD1→CauseOf→aph
437 35347213 8406 The presence of several ARGs presumably associated with iMGEs in the feed of dairy cows harbors the potential to affect the resident microbiota of the animals.
  1. associated→CauseOf→affect
  2. ARGs→CauseOf→associated
  3. ARGs→CauseOf→affect
  4. affect→CauseOf→associated
438 35347213 8409 Furthermore, ARGs can possibly spread further, to lower gastrointestinal (GI) regions.
  1. lower gastrointestinal→ThemeOf→ARGs
  2. ARGs→ThemeOf→lower gastrointestinal
439 35564054 8445 In conclusion, a ddPCR can be a reliable method for detecting and quantifying lactic acid bacteria in food.
  1. lactic→ThemeOf→ddPCR
  2. ddPCR→ThemeOf→lactic
440 35564054 8455 argentoratensis affected the fermentation stage of vegetables, such as kimchi.
  1. argentoratensis→CauseOf→affected
441 35637757 8565 DS1 as the evaluation index, the primary and secondary order of the four factors affecting the degradation rate is concentration > material size > temperature > time, and the optimal extraction condition is A3B3C3D2.
  1. degradation→ThemeOf→A3B3C3D2
  2. A3B3C3D2→ThemeOf→degradation
442 35637757 8575 When the concentration of hydrochloric acid increases, although hydroxyl-beta-sanshool is more stable than hydroxyl-alpha-sanshool, due to its highly unsaturated nature, it also eventually isomerizes.
  1. hydroxyl-beta-sanshool→ThemeOf→isomerizes
  2. isomerizes→ThemeOf→hydroxyl-beta-sanshool
443 35637757 8614 3(f)) is as follows: First, hydroxyl-alpha-sanshool was converted to hydroxyl-beta-sanshool, and then the carbonyl bond of hydroxyl-beta-sanshool was broken, which leads to isomerization and isomer formation under the action of hydrochloric acid: (1Z,2E,4E,8E,10E)-n-(2-hydroxy-2-methylpropyl)dodeca-2,4,8,10-tetraenimidic acid.
  1. 1Z,2E,4E,8E,10E→ThemeOf→isomer formation
  2. 1Z,2E,4E,8E,10E→CauseOf→leads to
  3. isomerization→ThemeOf→1Z,2E,4E,8E,10E
  4. isomerization→ThemeOf→leads to
  5. isomer formation→ThemeOf→1Z,2E,4E,8E,10E
  6. isomer formation→ThemeOf→leads to
  7. 1Z,2E,4E,8E,10E→ThemeOf→isomerization
444 35677055 8641 SLE is distinguished by the presence of high-titer serological autoantibodies, such as antibodies that bind to double-stranded DNA (dsDNA), SmRNP, SSA/Ro, and SSB/La.
  1. SmRNP→ThemeOf→SSB/La
  2. SmRNP→ThemeOf→SLE
  3. SSB/La→ThemeOf→SSA/Ro
  4. SSB/La→ThemeOf→SLE
  5. SSB/La→ThemeOf→SmRNP
  6. SSA/Ro→ThemeOf→SSB/La
  7. SSA/Ro→ThemeOf→SLE
  8. SLE→ThemeOf→SSB/La
  9. SLE→ThemeOf→SSA/Ro
  10. SLE→ThemeOf→SmRNP
445 35677055 8660 For example, L. delbrueckii and L. rhamnosus have been shown to be effective in the elevation of Tregs and the decrease of inflammatory cytokines and disease severity in SLE-induced mice.
  1. L. delbrueckii→CauseOf→elevation
  2. decrease→CauseOf→elevation
  3. L. rhamnosus→CauseOf→decrease
  4. elevation→CauseOf→decrease
  5. L. delbrueckii→CauseOf→decrease
  6. L. rhamnosus→CauseOf→elevation
446 35677055 8708 Moreover, L. delbrueckii and L. rhamnosus could decrease expression of CXCR3, CCR5, CCR4, and CCR3 on the tolerogenic phenotype of DCs in SLE patients.
  1. CCR5→ThemeOf→expression
  2. expression→ThemeOf→L. delbrueckii
  3. CCR3→ThemeOf→expression
  4. CCR5→ThemeOf→L. delbrueckii
  5. expression→ThemeOf→CCR3
  6. CCR3→ThemeOf→L. delbrueckii
  7. SLE→ThemeOf→CCR5
  8. CCR4→ThemeOf→SLE
  9. CCR4→ThemeOf→decrease
  10. L. delbrueckii→ThemeOf→CCR5
  11. SLE→ThemeOf→CCR4
  12. CCR4→ThemeOf→expression
  13. L. delbrueckii→CauseOf→decrease
  14. CCR4→ThemeOf→L. delbrueckii
  15. L. delbrueckii→ThemeOf→CCR4
  16. L. delbrueckii→ThemeOf→expression
  17. SLE→ThemeOf→CCR3
  18. expression→ThemeOf→CCR5
  19. L. delbrueckii→ThemeOf→CCR3
  20. CCR5→ThemeOf→SLE
  21. CCR3→ThemeOf→SLE
  22. CCR5→ThemeOf→decrease
  23. expression→ThemeOf→CCR4
  24. CCR3→ThemeOf→decrease
447 35677055 8709 Another study showed that Lactobacillus plantarum NCU116 increased the expression levels of Th17, Treg and specific transcription factors RORgammat and Foxp3 in CTX-induced immunosuppression mice.
  1. NCU116→ThemeOf→RORgammat
  2. Th17→ThemeOf→increased
  3. NCU116→ThemeOf→Th17
  4. Foxp3→ThemeOf→expression levels
  5. expression levels→ThemeOf→increased
  6. Foxp3→ThemeOf→NCU116
  7. expression levels→ThemeOf→Foxp3
  8. Foxp3→ThemeOf→increased
  9. expression levels→ThemeOf→RORgammat
  10. RORgammat→ThemeOf→expression levels
  11. expression levels→ThemeOf→Th17
  12. RORgammat→ThemeOf→NCU116
  13. RORgammat→ThemeOf→increased
  14. NCU116→CauseOf→increased
  15. Th17→ThemeOf→expression levels
  16. NCU116→ThemeOf→Foxp3
  17. Th17→ThemeOf→NCU116
448 35677055 8716 In addition, a randomized trial demonstrated that LGG has an immediate effect in the human gut with upregulating genes related to B cell activation.
  1. gut→ThemeOf→B cell activation
  2. gut→ThemeOf→LGG
  3. gut→ThemeOf→upregulating
  4. B cell activation→ThemeOf→gut
  5. B cell activation→ThemeOf→LGG
  6. B cell activation→ThemeOf→upregulating
  7. LGG→ThemeOf→gut
  8. LGG→ThemeOf→B cell activation
  9. LGG→CauseOf→upregulating
449 35677055 8717 After administration of Lactobacillus paracasei MCC1849, IgA secretion was elevated and Follicular helper T (Tfh) cells was induced in the BALB/c mice.
  1. induced→CauseOf→elevated
  2. elevated→CauseOf→induced
  3. MCC1849→CauseOf→induced
  4. MCC1849→CauseOf→elevated
450 35677055 8721 Dysregulation of Tregs and Th1/Th2/Th17 are involved in the pathogenesis of SLE.
  1. Dysregulation→ThemeOf→Tregs
  2. Dysregulation→CauseOf→involved
  3. Tregs→ThemeOf→Dysregulation
  4. Tregs→ThemeOf→involved
451 35677055 8763 To our best knowledge, although there were no adverse effects on the RCT trials of Lactobacillus on inflammatory bowel disease and rheumatoid arthritis, the adverse effects of Lactobacillus as probiotics must be further investigated utilizing additional antibiotic regimens, probiotic strain combinations, and human microbiome transplants into germ-free mice.
  1. inflammatory bowel disease→ThemeOf→Lactobacillus
  2. Lactobacillus→ThemeOf→rheumatoid arthritis
  3. Lactobacillus→ThemeOf→inflammatory bowel disease
  4. rheumatoid arthritis→ThemeOf→inflammatory bowel disease
  5. rheumatoid arthritis→ThemeOf→Lactobacillus
  6. inflammatory bowel disease→ThemeOf→rheumatoid arthritis
452 35693762 8794 In humans, Vgamma9Vdelta2 T cells are predominant circulating gammadelta T cells, whereas Vdelta1+ cells and fetal gammadelta T cells are commonly tissue-resident cells.
  1. gammadelta T→ThemeOf→Vgamma9Vdelta2
  2. Vgamma9Vdelta2→ThemeOf→gammadelta T
453 35693762 8795 In addition to their ability to release cytokines, subsets of gammadelta cells possess NK-like cytotoxicity via NK receptors, such as NKG2D.
  1. cytotoxicity→ThemeOf→gammadelta
  2. NK-like→ThemeOf→NKG2D
  3. NK-like→ThemeOf→gammadelta
  4. gammadelta→ThemeOf→NKG2D
  5. gammadelta→ThemeOf→cytotoxicity
  6. NKG2D→ThemeOf→NK-like
  7. gammadelta→ThemeOf→NK-like
  8. NKG2D→ThemeOf→gammadelta
454 35693762 8801 DN T cells are subdivided into four differentiation stages (DN1: CD44+CD25-; DN2: CD44+CD25+; DN3: CD44-CD25+; DN4: CD44-CD25-) (Figure 1B).
  1. CD44+CD25-→ThemeOf→DN1
  2. DN4→ThemeOf→CD44+CD25-
  3. DN1→ThemeOf→CD44+CD25-
  4. CD44+CD25-→ThemeOf→DN4
455 35693762 8803 Then, DP T cells interact with cortical epithelial cells expressing MHC molecules with self-antigens, which leads to a selection process where too weak signaling induces DP cell apoptosis.
  1. weak→CauseOf→induces
  2. induces→CauseOf→weak
  3. too→CauseOf→weak
  4. too→CauseOf→induces
456 35693762 8818 Although fetal Vgamma9Vdelta2 T cells slowly turn over and have self-renewal capacity, adult-derived Vgamma9Vdelta2 T cells can also be generated and be a major source human gammadelta T cells in the blood.
  1. Vgamma9Vdelta2→CauseOf→self-renewal capacity
  2. self-renewal capacity→CauseOf→Vgamma9Vdelta2
457 35693762 8821 CD27+CD44int cells actively secrete IFN-gamma, whereas CD27-CD44hi cells produce IL-17A.
  1. CD27+CD44int→ThemeOf→secrete IFN-gamma
  2. secrete IFN-gamma→ThemeOf→CD27+CD44int
458 35693762 8822 If gammadeltaTCR is weak, cells tend to preferentially differentiate into alphabeta T cells.
  1. gammadeltaTCR→CauseOf→weak
  2. alphabeta T→ThemeOf→gammadeltaTCR
  3. alphabeta T→ThemeOf→weak
  4. gammadeltaTCR→ThemeOf→alphabeta T
459 35693762 8844 T10/22, a MHC class Ib molecule, is also important for gammadelta T cell development.
  1. T10/22→ThemeOf→gammadelta T cell development
  2. T10/22→CauseOf→important
  3. gammadelta T cell development→ThemeOf→T10/22
  4. gammadelta T cell development→ThemeOf→important
460 35693762 8846 Phosphoantigens induce a conformational change in BTN3A1-BTN2A1 dimers, which binds to Vgamma9Vdelta2 TCR.
  1. TCR→ThemeOf→induce
  2. conformational→ThemeOf→Vgamma9Vdelta2
  3. induce→CauseOf→binds
  4. TCR→ThemeOf→binds
  5. conformational→ThemeOf→induce
  6. binds→CauseOf→induce
  7. TCR→ThemeOf→BTN3A1
  8. conformational→ThemeOf→binds
  9. BTN3A1→ThemeOf→TCR
  10. BTN2A1→ThemeOf→TCR
  11. conformational→ThemeOf→BTN3A1
  12. BTN3A1→ThemeOf→conformational
  13. BTN2A1→ThemeOf→conformational
  14. Vgamma9Vdelta2→ThemeOf→TCR
  15. BTN3A1→ThemeOf→Vgamma9Vdelta2
  16. BTN2A1→ThemeOf→Vgamma9Vdelta2
  17. Vgamma9Vdelta2→ThemeOf→BTN2A1
  18. BTN3A1→ThemeOf→induce
  19. BTN2A1→ThemeOf→induce
  20. Vgamma9Vdelta2→ThemeOf→conformational
  21. BTN3A1→ThemeOf→binds
  22. TCR→ThemeOf→BTN2A1
  23. BTN2A1→ThemeOf→binds
  24. Vgamma9Vdelta2→CauseOf→induce
  25. TCR→ThemeOf→conformational
  26. conformational→ThemeOf→TCR
  27. Vgamma9Vdelta2→CauseOf→binds
  28. TCR→ThemeOf→Vgamma9Vdelta2
  29. conformational→ThemeOf→BTN2A1
  30. Vgamma9Vdelta2→ThemeOf→BTN3A1
461 35693762 8848 Contrary to a number of reports that argued fetal thymus-derived gammadelta T cells are invariant, adult-derived gammadelta T cells have relatively variant TCR chains.
  1. TCR chains→ThemeOf→gammadelta
  2. gammadelta→ThemeOf→variant
  3. gammadelta→ThemeOf→TCR chains
  4. variant→CauseOf→TCR chains
  5. variant→ThemeOf→gammadelta
  6. TCR chains→CauseOf→variant
462 35693762 8850 In some cases, gammadelta T cells can be activated without TCR signaling, but activated by stress-induced molecules, such as MHC class I chain-related protein A/B (MICA/B) or retinoic acid early inducible 1 (Rae-1), via NKG2D receptor.
  1. NKG2D receptor→ThemeOf→activated
  2. MHC→ThemeOf→Rae-1
  3. NKG2D receptor→ThemeOf→MHC
  4. MHC→CauseOf→activated
  5. NKG2D receptor→ThemeOf→activated
  6. activated→CauseOf→activated
  7. gammadelta T cells→ThemeOf→activated
  8. Rae-1→ThemeOf→gammadelta T cells
  9. gammadelta T cells→ThemeOf→NKG2D receptor
  10. Rae-1→ThemeOf→activated
  11. gammadelta T cells→ThemeOf→Rae-1
  12. Rae-1→ThemeOf→MHC
  13. gammadelta T cells→ThemeOf→MHC
  14. Rae-1→ThemeOf→activated
  15. gammadelta T cells→ThemeOf→activated
  16. MHC→ThemeOf→gammadelta T cells
  17. activated→CauseOf→activated
  18. MHC→CauseOf→activated
  19. NKG2D receptor→ThemeOf→gammadelta T cells
  20. MHC→ThemeOf→NKG2D receptor
463 35693762 8875 However, because these phenotypes were not repeated under microglia- or astrocyte-specific deletion of IL-17R, direct evidence linking IL-17A and memory formation is still lacking and should be further addressed.
  1. deletion→ThemeOf→IL-17R
  2. deletion→ThemeOf→memory formation
  3. IL-17R→ThemeOf→deletion
  4. IL-17R→ThemeOf→memory formation
  5. memory formation→ThemeOf→deletion
  6. memory formation→ThemeOf→IL-17R
464 35693762 8879 Given the authors showed conditional deletion of Rorc using CD4-Cre mice, they concluded CD4 T cells are responsible for IL-17A production.
  1. deletion→ThemeOf→Rorc
  2. IL-17A production→ThemeOf→deletion
  3. IL-17A production→ThemeOf→Rorc
  4. Rorc→ThemeOf→deletion
  5. Rorc→ThemeOf→IL-17A production
  6. deletion→ThemeOf→IL-17A production
465 35693762 8893 On the other hand, Vdelta2+ T cells have strong cytotoxicity against oligodendrocytes.
  1. cytotoxicity→ThemeOf→Vdelta2+ T cells
  2. Vdelta2+ T cells→ThemeOf→cytotoxicity
466 35693762 8897 Another study showed that gut L. acidipiscis reduces Vgamma4+ cells while Vgamma1+ cells were increased.
  1. Vgamma1+ cells→ThemeOf→increased
  2. increased→CauseOf→reduces
  3. L. acidipiscis→CauseOf→increased
  4. reduces→CauseOf→increased
  5. L. acidipiscis→CauseOf→reduces
  6. Vgamma4+ cells→ThemeOf→increased
467 35693762 8906 While CD4 T cells induce tumor necrosis factor (TNF) production by macrophages via IFN-gamma, gammadelta T cells promote neutrophil infiltration through IL-17A (Figure 2C).
  1. CD4→ThemeOf→tumor necrosis factor
  2. tumor necrosis factor→ThemeOf→induce
  3. CD4→CauseOf→induce
  4. induce→CauseOf→promote
  5. TNF→ThemeOf→promote
  6. TNF→ThemeOf→CD4
  7. TNF→ThemeOf→induce
  8. promote→CauseOf→induce
  9. CD4→ThemeOf→TNF
  10. tumor necrosis factor→ThemeOf→promote
  11. CD4→CauseOf→promote
  12. tumor necrosis factor→ThemeOf→CD4
468 35693762 8941 IL-6 knock out mice have more CD8 T cells and less CD4 T cells and gammadelta T cells compared to WT mice.
  1. knock out→ThemeOf→IL-6
  2. CD4→ThemeOf→gammadelta
  3. CD8→ThemeOf→knock out
  4. knock out→ThemeOf→CD4
  5. CD4→ThemeOf→CD8
  6. CD8→ThemeOf→CD4
  7. knock out→CauseOf→less
  8. less→CauseOf→more
  9. CD8→ThemeOf→less
  10. knock out→CauseOf→more
  11. more→CauseOf→less
  12. CD8→ThemeOf→more
  13. knock out→ThemeOf→gammadelta
  14. gammadelta→ThemeOf→IL-6
  15. CD8→ThemeOf→gammadelta
  16. IL-6→ThemeOf→knock out
  17. knock out→ThemeOf→CD8
  18. gammadelta→ThemeOf→knock out
  19. IL-6→ThemeOf→CD4
  20. CD4→ThemeOf→IL-6
  21. gammadelta→ThemeOf→CD4
  22. IL-6→ThemeOf→less
  23. CD4→ThemeOf→knock out
  24. gammadelta→ThemeOf→less
  25. IL-6→ThemeOf→more
  26. CD4→ThemeOf→less
  27. gammadelta→ThemeOf→more
  28. IL-6→ThemeOf→gammadelta
  29. CD4→ThemeOf→more
  30. gammadelta→ThemeOf→CD8
469 35693762 8967 A study showed gammadelta T cell were mostly correlated to better prognosis among multiple tumor-infiltrating immune cells.
  1. tumor→ThemeOf→gammadelta
  2. tumor→ThemeOf→correlated
  3. gammadelta→ThemeOf→tumor
  4. gammadelta→CauseOf→correlated
470 35693762 8971 Also, our group showed gammadelta T cells are associated with longer survival of brain tumor patients.
  1. gammadelta T cells→CauseOf→longer
  2. brain tumor→ThemeOf→gammadelta T cells
  3. brain tumor→ThemeOf→longer
  4. gammadelta T cells→ThemeOf→brain tumor
471 35693762 8979 In this study, anti-gammadeltaTCR antibody administration also abrogated gammadelta T cell-mediated antitumor functions.
  1. anti-gammadeltaTCR→CauseOf→anti-gammadeltaTCR antibody
  2. tumor→ThemeOf→gammadelta T
  3. anti-gammadeltaTCR→ThemeOf→tumor
  4. tumor→ThemeOf→anti-gammadeltaTCR antibody
  5. anti-gammadeltaTCR→CauseOf→abrogated
  6. gammadelta T→ThemeOf→anti-gammadeltaTCR
  7. gammadelta T→ThemeOf→tumor
  8. gammadelta T→ThemeOf→abrogated
  9. anti-gammadeltaTCR antibody→ThemeOf→anti-gammadeltaTCR
  10. anti-gammadeltaTCR antibody→ThemeOf→tumor
  11. anti-gammadeltaTCR antibody→ThemeOf→abrogated
  12. anti-gammadeltaTCR→ThemeOf→gammadelta T
  13. tumor→ThemeOf→anti-gammadeltaTCR
472 35693762 8989 Vgamma9Vdelta2 T cells were also able to target glioma stem cells (GSCs).
  1. Vgamma9Vdelta2→CauseOf→target
473 35693762 8998 Because the beneficial effect of gammadelta T cells in low-grade glioma (LGG) was clearer than HGG, gammadelta T cells may also have antitumor effects against other brain tumors, such as meningioma.
  1. gammadelta T cells→CauseOf→beneficial
  2. gammadelta T cells→CauseOf→beneficial
474 35730767 10209 BACKGROUND: The soy isoflavone microbial metabolites dihydrodaidzein (DHD), dihydrogenistein (DHG), equol and 5-hydroxy-equol, are generally more biologically active than their precursors, daidzein and genistein.
  1. dihydrodaidzein→CauseOf→more
475 35730767 10215 Moreover, the DPPH free radical-scavenging capacity of soymilk fermented with HAU-FR7 was significantly higher than that of unfermented soymilk.
  1. HAU-FR7→ThemeOf→DPPH free radical-scavenging capacity
  2. HAU-FR7→CauseOf→higher
  3. DPPH free radical-scavenging capacity→ThemeOf→HAU-FR7
  4. DPPH free radical-scavenging capacity→ThemeOf→higher
476 35812872 9031 Then the birds were all euthanized and evaluated using the WB myopathy scoring system based on the area of palpable firmness, reported by Sihvo et al.. For short, we manually palpated and classified 300 chicken filets into three kinds of breast filets based on the texture and firmness: normal breast (NORM), mild wooden breast (MILD), and severe wooden breast (SEV).
  1. mild wooden breast→ThemeOf→firmness
  2. firmness→ThemeOf→MILD
  3. mild wooden breast→ThemeOf→firmness
  4. firmness→ThemeOf→WB myopathy
  5. mild wooden breast→ThemeOf→MILD
  6. MILD→ThemeOf→mild wooden breast
  7. mild wooden breast→ThemeOf→WB myopathy
  8. MILD→ThemeOf→firmness
  9. firmness→ThemeOf→mild wooden breast
  10. MILD→ThemeOf→firmness
  11. firmness→ThemeOf→firmness
  12. MILD→ThemeOf→WB myopathy
  13. firmness→ThemeOf→MILD
  14. WB myopathy→ThemeOf→mild wooden breast
  15. firmness→ThemeOf→WB myopathy
  16. WB myopathy→ThemeOf→firmness
  17. firmness→ThemeOf→mild wooden breast
  18. WB myopathy→ThemeOf→firmness
  19. firmness→ThemeOf→firmness
  20. WB myopathy→ThemeOf→MILD
477 35812872 9052 By contrast, the mean myofiber area and average myofiber width in SEV filets were lower than those in the NORM and MILD filets (P < 0.001).
  1. average myofiber width→ThemeOf→SEV
  2. SEV→CauseOf→lower
  3. SEV→ThemeOf→average myofiber width
  4. SEV→ThemeOf→MILD
  5. MILD→ThemeOf→lower
  6. MILD→ThemeOf→SEV
478 35812872 9059 In addition, the abundance of Verrucomicrobia also decreased in birds with mild WB (P < 0.05, Figure 3D, right).
  1. mild WB→CauseOf→decreased
479 35812872 9080 Hence, fragmented myofibers in severe WB was responsible for a bad water-holding capacity and other alternation in meat quality.
  1. fragmented→CauseOf→bad
480 35812872 9092 Arginine was also reported to stimulate muscle protein synthesis by inducing the phosphorylation of mTOR in skeletal muscles.
  1. mTOR→ThemeOf→stimulate
  2. Arginine→CauseOf→stimulate
  3. phosphorylation→ThemeOf→inducing
  4. mTOR→ThemeOf→muscle protein
  5. Arginine→ThemeOf→mTOR
  6. mTOR→ThemeOf→Arginine
  7. Arginine→ThemeOf→muscle protein
  8. mTOR→ThemeOf→inducing
  9. Arginine→CauseOf→inducing
  10. mTOR→ThemeOf→phosphorylation
  11. Arginine→ThemeOf→phosphorylation
  12. muscle protein→ThemeOf→stimulate
  13. inducing→CauseOf→stimulate
  14. muscle protein→ThemeOf→mTOR
  15. phosphorylation→ThemeOf→stimulate
  16. muscle protein→ThemeOf→Arginine
  17. phosphorylation→ThemeOf→mTOR
  18. muscle protein→ThemeOf→inducing
  19. phosphorylation→ThemeOf→muscle protein
  20. stimulate→CauseOf→inducing
  21. muscle protein→ThemeOf→phosphorylation
  22. phosphorylation→ThemeOf→Arginine
481 35812872 9096 The glutamine association with thyroid hormones regulates muscle weight and fiber diameter in resting and atrophic conditions and results in protection from muscle loss during atrophy.
  1. atrophic conditions→ThemeOf→fiber diameter
  2. atrophy→ThemeOf→atrophic conditions
  3. fiber diameter→ThemeOf→regulates
  4. glutamine→ThemeOf→atrophic conditions
  5. atrophic conditions→ThemeOf→protection
  6. atrophy→ThemeOf→muscle
  7. protection→ThemeOf→glutamine
  8. glutamine→ThemeOf→muscle
  9. atrophic conditions→ThemeOf→regulates
  10. atrophy→ThemeOf→fiber diameter
  11. protection→ThemeOf→atrophic conditions
  12. glutamine→ThemeOf→atrophy
  13. muscle→ThemeOf→glutamine
  14. atrophy→ThemeOf→protection
  15. protection→ThemeOf→muscle
  16. glutamine→ThemeOf→fiber diameter
  17. muscle→ThemeOf→atrophic conditions
  18. atrophy→ThemeOf→regulates
  19. protection→ThemeOf→atrophy
  20. glutamine→ThemeOf→protection
  21. muscle→ThemeOf→atrophy
  22. fiber diameter→ThemeOf→glutamine
  23. protection→ThemeOf→fiber diameter
  24. glutamine→CauseOf→regulates
  25. muscle→ThemeOf→fiber diameter
  26. fiber diameter→ThemeOf→atrophic conditions
  27. protection→ThemeOf→regulates
  28. atrophic conditions→ThemeOf→glutamine
  29. muscle→ThemeOf→protection
  30. fiber diameter→ThemeOf→muscle
  31. atrophic conditions→ThemeOf→muscle
  32. muscle→ThemeOf→regulates
  33. fiber diameter→ThemeOf→atrophy
  34. atrophic conditions→ThemeOf→atrophy
  35. atrophy→ThemeOf→glutamine
  36. fiber diameter→ThemeOf→protection
482 35812872 9111 Choline, an essential nutrient for skeletal muscle, is a precursor of Ach, and ion replacement of K+ with choline+ results in potent inhibition of sarcoplasmic/endoplasmic reticulum Ca2+ ATPase in the sarcoplasmic/endoplasmic reticulum of skeletal muscles.
  1. replacement→ThemeOf→Ca2+
  2. replacement→CauseOf→inhibition
  3. replacement→ThemeOf→sarcoplasmic/endoplasmic reticulum
  4. sarcoplasmic/endoplasmic reticulum→ThemeOf→Ca2+
  5. sarcoplasmic/endoplasmic reticulum→ThemeOf→replacement
  6. sarcoplasmic/endoplasmic reticulum→ThemeOf→inhibition
  7. Ca2+→ThemeOf→replacement
  8. Ca2+→ThemeOf→inhibition
  9. Ca2+→ThemeOf→sarcoplasmic/endoplasmic reticulum
483 36230139 9267 Some Lactobacilli have been reported as strains with high probiotic potential and support efforts to improve probiotic quality, such as L. salivarius strains BCRC14759 and BCRC 12574, with the highest exopolysaccharide production, L. johnsonii ZLJ010, with better adaptation to the gut environment and its probiotic functionalities, and L. helveticus D75 and D76 that can inhibit the growth of pathogens and pathobionts.
  1. L. helveticus D75→CauseOf→inhibit
  2. BCRC14759→CauseOf→inhibit
  3. D75→CauseOf→inhibit
484 36230139 9317 Mutation breeding of Lactobacilli strains can change the genetic structure and function of Lactobacilli strains, and then screen mutants to obtain the required high-yield and high-quality strains.
  1. Mutation→CauseOf→change
  2. Mutation→ThemeOf→genetic structure
  3. Mutation→ThemeOf→function
  4. genetic structure→ThemeOf→change
  5. genetic structure→ThemeOf→Mutation
  6. genetic structure→ThemeOf→function
  7. function→ThemeOf→change
  8. function→ThemeOf→Mutation
  9. function→ThemeOf→genetic structure
485 36557680 9621 With respect to the genome size, Weissella has a smaller pool of genes compared to other fecal commensal bacteria belonging to the genera Parabacteroides, Bacteroides, Lactobacillus, and Pediococcus.
  1. Weissella→CauseOf→smaller
  2. Weissella→ThemeOf→pool
  3. pool→ThemeOf→Weissella
  4. pool→ThemeOf→smaller
486 36557680 9665 In addition, Weissella seems to play an important role in the reduction of a depression-like state and in the strengthening of the gut epithelial barrier.
  1. strengthening→CauseOf→reduction
  2. Weissella→CauseOf→reduction
  3. Weissella→CauseOf→strengthening
  4. reduction→CauseOf→strengthening
487 36557680 9666 Among Weissella species, W. confusa is one of the most important EPS producers, and different W. confusa strains, such as W. confusa VP30, XG-3, and KR780676, produce several EPSs with distinct functions.
  1. KR780676→CauseOf→produce
  2. KR780676→ThemeOf→EPS
  3. W. confusa→ThemeOf→EPS
  4. W. confusa→CauseOf→produce
  5. W. confusa→ThemeOf→EPS
  6. EPS→ThemeOf→KR780676
  7. EPS→ThemeOf→EPS
  8. EPS→ThemeOf→produce
  9. EPS→ThemeOf→KR780676
  10. EPS→ThemeOf→W. confusa
  11. EPS→ThemeOf→produce
  12. EPS→ThemeOf→EPS
  13. EPS→ThemeOf→W. confusa
  14. KR780676→ThemeOf→EPS
488 36557680 9687 The thermostable 'weissellicin D' exhibited a broad range of antibacterial activity against many food-borne pathogens, such as E. coli, S. aureus, and L. monocytogenes.
  1. antibacterial→ThemeOf→'weissellicin D
  2. 'weissellicin D→ThemeOf→antibacterial
489 36557680 9697 Both weissellicin Y and weissellicin M possess broad antimicrobial spectra specifically targeted against B. coagulans.
  1. weissellicin Y→ThemeOf→antimicrobial
  2. weissellicin M→ThemeOf→antimicrobial
  3. antimicrobial→ThemeOf→weissellicin Y
  4. antimicrobial→ThemeOf→weissellicin M
490 36557680 9698 Between the two, weissellicin M showed comparatively higher antibacterial activity, as well as greater acid and thermal stability when compared to weissellicin Y.
  1. weissellicin M→CauseOf→higher
  2. weissellicin M→ThemeOf→antibacterial activity
  3. antibacterial activity→ThemeOf→higher
  4. antibacterial activity→ThemeOf→weissellicin M
491 36557680 9713 examined the antibacterial activity of W. confusa DD_A7 isolated from kimchi and found that the DD-A7 strains trigger the oxidative stress to inhibit the growth of extended-spectrum beta-lactamase (ESBL)-positive E. coli, which are emerging pathogens.
  1. DD-A7→CauseOf→inhibit
  2. DD-A7→CauseOf→trigger
  3. inhibit→CauseOf→trigger
  4. trigger→CauseOf→inhibit
492 36557680 9733 For example, W. paramesenteroides WpK4 was able to reduce the disease activity index (DAI) as well as repair some of the mucosal damage in mice models with DSS-induced colitis.
  1. WpK4→CauseOf→reduce
  2. reduce→CauseOf→repair
  3. W. paramesenteroides WpK4→CauseOf→repair
  4. W. paramesenteroides WpK4→CauseOf→reduce
  5. repair→CauseOf→reduce
  6. WpK4→CauseOf→repair
493 36677358 9885 Based on the VIP scores of PLS-DA (Figure 7B), zOTU_3 (Kluyveromyces marxianus) was highly associated with Kopanisti A, and zOTU_2 (Torulaspora delbrueckii) and zOTU_12 (Mucor circinelloides) with Kopanisti D, as also revealed by the compositional analysis at the genus level (Figure 6A).
  1. zOTU_2→CauseOf→associated
  2. zOTU_3→CauseOf→associated
494 36677358 9892 Among the other three types, although not in a statistically significant mode, Kopanisti A received the highest score in structure and texture, Kopanisti C in flavour and appearance and Kopanisti D in aroma and after-taste.
  1. texture→ThemeOf→structure
  2. aroma→CauseOf→Kopanisti
  3. appearance→ThemeOf→aroma
  4. flavour→ThemeOf→appearance
  5. Kopanisti→CauseOf→flavour
  6. after-taste→ThemeOf→structure
  7. structure→CauseOf→Kopanisti
  8. texture→CauseOf→Kopanisti
  9. aroma→ThemeOf→appearance
  10. appearance→ThemeOf→highest
  11. flavour→ThemeOf→highest
  12. Kopanisti→CauseOf→after-taste
  13. after-taste→CauseOf→Kopanisti
  14. Kopanisti→CauseOf→texture
  15. Kopanisti→CauseOf→texture
  16. aroma→ThemeOf→highest
  17. appearance→ThemeOf→flavour
  18. flavour→CauseOf→Kopanisti
  19. Kopanisti→CauseOf→structure
  20. structure→ThemeOf→texture
  21. Kopanisti→CauseOf→aroma
  22. texture→CauseOf→Kopanisti
  23. Kopanisti→CauseOf→aroma
  24. aroma→ThemeOf→flavour
  25. appearance→CauseOf→Kopanisti
  26. flavour→ThemeOf→after-taste
  27. after-taste→ThemeOf→texture
  28. structure→CauseOf→Kopanisti
  29. Kopanisti→CauseOf→appearance
  30. texture→ThemeOf→aroma
  31. Kopanisti→CauseOf→appearance
  32. aroma→CauseOf→Kopanisti
  33. appearance→ThemeOf→after-taste
  34. flavour→ThemeOf→structure
  35. after-taste→CauseOf→Kopanisti
  36. structure→ThemeOf→aroma
  37. Kopanisti→CauseOf→highest
  38. texture→ThemeOf→appearance
  39. Kopanisti→CauseOf→highest
  40. aroma→ThemeOf→after-taste
  41. appearance→ThemeOf→structure
  42. flavour→CauseOf→Kopanisti
  43. after-taste→ThemeOf→aroma
  44. structure→ThemeOf→appearance
  45. Kopanisti→CauseOf→flavour
  46. texture→ThemeOf→highest
  47. Kopanisti→CauseOf→flavour
  48. aroma→ThemeOf→structure
  49. appearance→CauseOf→Kopanisti
  50. Kopanisti→CauseOf→texture
  51. after-taste→ThemeOf→appearance
  52. structure→ThemeOf→highest
  53. Kopanisti→CauseOf→after-taste
  54. texture→ThemeOf→flavour
  55. Kopanisti→CauseOf→after-taste
  56. aroma→CauseOf→Kopanisti
  57. flavour→ThemeOf→texture
  58. Kopanisti→CauseOf→aroma
  59. after-taste→ThemeOf→highest
  60. structure→ThemeOf→flavour
  61. Kopanisti→CauseOf→structure
  62. texture→CauseOf→Kopanisti
  63. Kopanisti→CauseOf→structure
  64. appearance→ThemeOf→texture
  65. flavour→CauseOf→Kopanisti
  66. Kopanisti→CauseOf→appearance
  67. after-taste→ThemeOf→flavour
  68. structure→CauseOf→Kopanisti
  69. texture→ThemeOf→after-taste
  70. aroma→ThemeOf→texture
  71. appearance→CauseOf→Kopanisti
  72. flavour→ThemeOf→aroma
  73. Kopanisti→CauseOf→highest
  74. after-taste→CauseOf→Kopanisti
  75. structure→ThemeOf→after-taste
495 36766173 9942 In addition, butyrate esters contribute to the flavor of Baijiu, for example, phenylethyl butyrate has the aroma of floral, green with a tropical winey nuance; ethyl butyrate has the aroma of sweet, apple like, fresh and lifting, ethereal; isoamyl butyrate has the aroma of wax, green apple, fruit, sweet, berry; propyl butyrate has the aroma of sweet, bubble gum and pineapple like with a light green nuance; and isobutyl butyrate has sweet, fruity, pineapple, apple, bubble gum, and tropical fruit flavors.
  1. propyl→ThemeOf→sweet
  2. sweet→ThemeOf→isoamyl
  3. sweet→ThemeOf→isobutyl butyrate
  4. sweet→ThemeOf→propyl
  5. isoamyl→ThemeOf→sweet
  6. isobutyl butyrate→ThemeOf→sweet
496 36766173 9950 For Clostridium, Clostridium sensu stricto 12, Clostridium sensu stricto 11, and Clostridium sensu stricto 1 were the dominant microorganisms, among which Clostridium sensu stricto 12 increased gradually in the early fermentation stage, while those of Clostridium sensu stricto 11 and Clostridium sensu stricto 1 increased and stabilized in the middle and late fermentation stages.
  1. Clostridium→CauseOf→increased
497 36766173 9967 Among which, there were five positive interactions in the three genera of Lactobacillus, Weissella, and Lactococcus, while the fungal genus Saccharomyces showed significant positive interactions with four bacterial genera, including Lactobacillus, Weissella, Lactococcus, and Clostridium sensu strictto 12 (Figure 6b).
  1. interactions→CauseOf→Weissella
  2. Weissella→CauseOf→interactions
  3. Weissella→CauseOf→positive
  4. Weissella→CauseOf→interactions
  5. interactions→ThemeOf→positive
  6. interactions→ThemeOf→interactions
  7. interactions→CauseOf→Weissella
  8. interactions→ThemeOf→interactions
  9. interactions→ThemeOf→positive
498 36766173 10006 Although the abundance of Monascus was lower than that of the other two fungal genera (Aspergillus and Saccharomyces), it also showed a contribution to most of the flavor compounds in all samples, especially in sample 4, Monascus was positively correlated with a20 (hexanoic acid, ethyl ester) (Figure 8c).
  1. Monascus→CauseOf→correlated
499 36845507 10054 Among LAB, the genera Aerococcus, Carnobacterium, Enterococcus, Tetragenococcus, Lactobacillus, Pediococcus, Leuconostoc, Weissella, Lactococcus, and Streptococcus were detected in the commercial makgeolli samples.
  1. Weissella→CauseOf→detected
500 36845507 10058 Among all LAB genera, the genus Lactobacillus was dominant, accounting for 55.76% of the LAB genera, followed by Leuconostoc (16.32%), Weissella (11.86%), Pediococcus (11.04%), and Lactococcus (4.02%).
  1. Weissella→ThemeOf→Lactobacillus
  2. Pediococcus→ThemeOf→Weissella
  3. Weissella→ThemeOf→Lactococcus
  4. Pediococcus→ThemeOf→Lactobacillus
  5. Weissella→ThemeOf→Pediococcus
  6. Lactobacillus→ThemeOf→Weissella
  7. Lactobacillus→ThemeOf→Lactococcus
  8. Lactobacillus→ThemeOf→Pediococcus
  9. Leuconostoc→ThemeOf→Weissella
  10. Lactococcus→ThemeOf→Leuconostoc
  11. Leuconostoc→ThemeOf→Lactococcus
  12. Lactococcus→ThemeOf→Weissella
  13. Leuconostoc→ThemeOf→Pediococcus
  14. Lactococcus→ThemeOf→Lactobacillus
  15. Weissella→ThemeOf→Leuconostoc
  16. Pediococcus→ThemeOf→Leuconostoc
501 36845507 10059 Lactobacillus, the most abundant genus, accounted for an average of 32.61 +- 27.31% of the relative abundance in the makgeolli microbiome, followed by Leuconostoc, Weissella, and Pediococcus.
  1. Weissella→ThemeOf→Pediococcus
  2. Weissella→ThemeOf→Leuconostoc
  3. Pediococcus→ThemeOf→Weissella
  4. Leuconostoc→ThemeOf→Weissella
502 36845507 10060 Similarly, the most frequent LAB genus detected in all samples was Lactobacillus, followed by Leuconostoc, Weissella, Lactococcus, and Pediococcus.
  1. Lactococcus→ThemeOf→Weissella
  2. Leuconostoc→ThemeOf→Lactococcus
  3. Lactococcus→ThemeOf→Lactobacillus
  4. Leuconostoc→ThemeOf→Pediococcus
  5. Lactococcus→ThemeOf→Leuconostoc
  6. Lactobacillus→ThemeOf→Weissella
  7. Lactobacillus→ThemeOf→Lactococcus
  8. Lactobacillus→ThemeOf→Pediococcus
  9. Weissella→ThemeOf→Lactococcus
  10. Pediococcus→ThemeOf→Weissella
  11. Weissella→ThemeOf→Lactobacillus
  12. Pediococcus→ThemeOf→Lactobacillus
  13. Weissella→ThemeOf→Pediococcus
  14. Pediococcus→ThemeOf→Leuconostoc
  15. Weissella→ThemeOf→Leuconostoc
  16. Leuconostoc→ThemeOf→Weissella
503 36845507 10069 3a shows that the commercial makgeolli products prepared using nuruk demonstrated a higher relative abundance of the genera Pediococcus and Leuconostoc and a lower relative abundance of the genus Streptococcus compared to that in the samples without nuruk.
  1. genera→ThemeOf→higher
  2. Pediococcus→ThemeOf→relative abundance
  3. nuruk→CauseOf→higher
  4. Leuconostoc→ThemeOf→genera
  5. genera→ThemeOf→relative abundance
  6. Pediococcus→CauseOf→nuruk
  7. nuruk→ThemeOf→relative abundance
  8. Leuconostoc→ThemeOf→relative abundance
  9. higher→CauseOf→lower
  10. genera→ThemeOf→Pediococcus
  11. Pediococcus→ThemeOf→lower
  12. nuruk→CauseOf→genera
  13. Leuconostoc→CauseOf→nuruk
  14. relative abundance→ThemeOf→higher
  15. genera→ThemeOf→relative abundance
  16. relative abundance→ThemeOf→higher
  17. nuruk→CauseOf→Pediococcus
  18. Leuconostoc→ThemeOf→lower
  19. relative abundance→ThemeOf→genera
  20. genera→CauseOf→nuruk
  21. relative abundance→ThemeOf→relative abundance
  22. nuruk→ThemeOf→relative abundance
  23. relative abundance→ThemeOf→Pediococcus
  24. genera→ThemeOf→lower
  25. relative abundance→ThemeOf→genera
  26. nuruk→CauseOf→lower
  27. relative abundance→ThemeOf→relative abundance
  28. genera→ThemeOf→Leuconostoc
  29. relative abundance→ThemeOf→Pediococcus
  30. nuruk→CauseOf→Leuconostoc
  31. relative abundance→ThemeOf→nuruk
  32. Pediococcus→ThemeOf→higher
  33. relative abundance→ThemeOf→nuruk
  34. lower→CauseOf→higher
  35. Pediococcus→ThemeOf→relative abundance
  36. Leuconostoc→ThemeOf→higher
  37. relative abundance→ThemeOf→Leuconostoc
  38. Pediococcus→ThemeOf→genera
  39. relative abundance→ThemeOf→Leuconostoc
  40. Leuconostoc→ThemeOf→relative abundance
504 36845507 10078 Notably, 18 species were reported for the first time in rice wine, including Carnobacterium viridans, Enterococcus casseliflavus, Tetragenococcus halophilus, Lactobacillus hamsteri, Lactobacillus helveticus, Lactobacillus manihotivorans, Lactobacillus paralimentarius, Lactobacillus paraplantarum, Lactobacillus pontis, Lactobacillus zeae, Pediococcus ethanolidurans, Leuconostoc fallax, Weissella beninensis, Weissella ghanensis, Weissella hellenica, Weissella viridescens, Lactococcus garvieae, and Streptococcus luteciae.
  1. Weissella hellenica→ThemeOf→Lactococcus
  2. Lactococcus→ThemeOf→Weissella hellenica
  3. Lactococcus→ThemeOf→Weissella viridescens
  4. Weissella viridescens→ThemeOf→Lactococcus
505 36845507 10083 According to Chai et al., LAB genera dominated the makgeolli system from day 2, with the population shifting complementarily between Pediococcus and Weissella.
  1. makgeolli→ThemeOf→Weissella
  2. Weissella→ThemeOf→makgeolli
506 36845507 10088 In addition, some strains of Enterococcus casseliflavus, Tetragenococcus halophilus, Lactobacillus delbrueckii, Lactobacillus paraplantarum, Lactobacillus zeae, Pediococcus acidilactici, Leuconostoc mesenteroides, Weissella hellenica, Weissella paramesenteroides, and Lactococcus garvieae, which were detected in this study, have been reported to possess probiotic potential.
  1. Weissella→CauseOf→Enterococcus
  2. Weissella→CauseOf→Lactococcus
  3. Enterococcus→CauseOf→Weissella
  4. Enterococcus→CauseOf→Weissella
  5. Weissella→CauseOf→Enterococcus
  6. Weissella→CauseOf→Lactococcus
  7. Lactococcus→CauseOf→Weissella
  8. Lactococcus→CauseOf→Weissella
507 36981219 4 In addition, certain LAB strains are capable of transforming isoflavone aglycones into compounds with a greater biological activity, such as dihydrodaidzein (DHD), O-desmethylangolensin (O-DMA), dihydrogenistein (DHG) and 6-hydroxy-O-desmethylangolensin (6-OH-O-DMA).
  1. O-desmethylangolensin→ThemeOf→dihydrodaidzein
  2. biological activity→ThemeOf→O-desmethylangolensin
  3. DHG→ThemeOf→O-desmethylangolensin
  4. O-desmethylangolensin→ThemeOf→biological activity
  5. biological activity→ThemeOf→dihydrodaidzein
  6. DHG→ThemeOf→dihydrodaidzein
  7. O-desmethylangolensin→ThemeOf→6-hydroxy-O-desmethylangolensin
  8. biological activity→ThemeOf→6-hydroxy-O-desmethylangolensin
  9. DHG→ThemeOf→biological activity
  10. O-desmethylangolensin→ThemeOf→transforming
  11. biological activity→ThemeOf→transforming
  12. DHG→ThemeOf→6-hydroxy-O-desmethylangolensin
  13. O-desmethylangolensin→ThemeOf→DHG
  14. biological activity→ThemeOf→DHG
  15. DHG→CauseOf→transforming
  16. dihydrodaidzein→ThemeOf→O-desmethylangolensin
  17. 6-hydroxy-O-desmethylangolensin→ThemeOf→O-desmethylangolensin
  18. dihydrodaidzein→ThemeOf→biological activity
  19. 6-hydroxy-O-desmethylangolensin→ThemeOf→dihydrodaidzein
  20. dihydrodaidzein→ThemeOf→6-hydroxy-O-desmethylangolensin
  21. 6-hydroxy-O-desmethylangolensin→ThemeOf→biological activity
  22. dihydrodaidzein→ThemeOf→transforming
  23. 6-hydroxy-O-desmethylangolensin→ThemeOf→transforming
  24. dihydrodaidzein→ThemeOf→DHG
  25. 6-hydroxy-O-desmethylangolensin→ThemeOf→DHG
508 36981219 6 Another strategy in the bioconversion of isoflavones is the heterologous expression of genes from Slackia isoflavoniconvertens DSM22006, which have <