Lacidipiscis

序号	PMID	SentID	Sentence	Chian
1	16825650	10098	The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities.	L. acidipiscis→ThemeOf→rpoA L. acidipiscis→ThemeOf→atpA rpoA→ThemeOf→L. acidipiscis atpA→ThemeOf→L. acidipiscis
2	17696886	192	After frozen storage (-20 to -30 C for 5-8 weeks), C. divergens and C. maltaromaticum seem to be particularly prominent in chilled MAP fish, as has been reported for cod, garfish, salmon, and tuna.	C. maltaromaticum→CauseOf→prominent
3	17696886	222	Thus, amino acid substitutions closer to the N-terminus in carnobacteriocin B2 drastically reduced or eliminated antimicrobial activity, whereas this was not so for substitutions close to the C-terminal part.	substitutions→CauseOf→eliminated substitutions→CauseOf→reduced reduced→CauseOf→eliminated eliminated→CauseOf→reduced
4	17696886	226	Chemical oxidation of tryptophan residues by N-bromosuccinimide showed that these residues were crucial for inhibitory activity, as modification of any one of them rendered divercin V41 inactive.	inhibitory activity→ThemeOf→rendered inhibitory activity→ThemeOf→divercin inhibitory activity→ThemeOf→modification inhibitory activity→ThemeOf→inactive modification→CauseOf→rendered rendered→CauseOf→inactive modification→ThemeOf→divercin divercin→ThemeOf→rendered modification→ThemeOf→inhibitory activity divercin→ThemeOf→inhibitory activity modification→CauseOf→inactive divercin→ThemeOf→modification inactive→CauseOf→rendered divercin→ThemeOf→inactive
5	17696886	256	Therefore, it has been suggested that a C. divergens strain in which the tyrosine decarboxylase gene is inactivated by mutagenesis could be used as a protective culture to prevent growth of L. monocytogenes in cold-smoked salmon.	tyrosine→ThemeOf→inactivated tyrosine→ThemeOf→mutagenesis growth→ThemeOf→tyrosine growth→ThemeOf→inactivated growth→ThemeOf→mutagenesis mutagenesis→ThemeOf→tyrosine mutagenesis→ThemeOf→growth mutagenesis→CauseOf→inactivated tyrosine→ThemeOf→growth
6	17696886	286	Production by C. maltaromaticum of alcohols and aldehydes from valine, leucine and/or isoleucine resulted in a malty, green aroma in skimmed milk and shrimp, and has also caused spoilage of cured ham (Table 4).	isoleucine→CauseOf→caused resulted in→CauseOf→caused isoleucine→CauseOf→resulted in caused→CauseOf→resulted in
7	17696886	307	Finally, C. maltaromaticum has been shown to cause a softer texture of salmon fillets when inoculated in high numbers.	C. maltaromaticum→CauseOf→cause C. maltaromaticum→ThemeOf→softer softer→ThemeOf→C. maltaromaticum softer→ThemeOf→cause
8	17696886	333	It is, therefore, not surprising that C. maltaromaticum and C. maltaromaticum-like strains are also found in the intestine or gills of healthy fish, including Arctic charr, Atlantic cod, Atlantic salmon, brown bullhead, trout, and various freshwater fish.	C. maltaromaticum-like→CauseOf→found
9	17696886	339	Carnobacterium divergens and C. maltaromaticum enhance the cellular and humoral immune responses and cytokine expression ratios of rainbow trout.	C. maltaromaticum→CauseOf→enhance
10	17696886	344	This specific case of pathogenesis is probably best understood as a result of opportunistic infection, although C. maltaromaticum (but not C. divergens, C. gallinarum, C. inhibens, C. mobile or C. viridans) exerts chitinolytic acitivity (Leisner & Ingmer, unpublished data), a feature that can be perceived as targeting the chitin-containing exoskeleton of insects.	C. maltaromaticum→CauseOf→exerts
11	17696886	360	This may, in some instances, be due to faulty methodology for detecting carnobacteria.	carnobacteria→ThemeOf→faulty faulty→ThemeOf→carnobacteria
12	18048734	412	The DNA G+C content of their closest relatives, L. salivarius JCM 1231T and L. aviarius subsp.	DNA G+C content→ThemeOf→L. salivarius L. salivarius→ThemeOf→DNA G+C content
13	18048734	418	Since KBL13T and GBL13 were found to be the same species, KBL13T was used as a representative strain in the experiments described below.	KBL13T→ThemeOf→GBL13 GBL13→ThemeOf→KBL13T
14	18048734	421	DNA-DNA relatedness values between KBL13T and L. salivarius JCM 1231T and JCM 1150, and L. aviarius subsp.	JCM 1231T→ThemeOf→DNA-DNA relatedness DNA-DNA relatedness→ThemeOf→JCM 1231T
15	19783610	10105	Furthermore, the new isolates could be differentiated clearly from L. acidipiscis NBRC 102163T and NBRC 102164 in terms of acid production from L-arabinose, rhamnose, mannitol, lactose and 5-ketogluconate.	mannitol→ThemeOf→rhamnose lactose→ThemeOf→rhamnose acid production from L-arabinose→ThemeOf→NBRC 102163T NBRC→CauseOf→mannitol NBRC 102163T→ThemeOf→mannitol acid production from L-arabinose→ThemeOf→mannitol NBRC→CauseOf→acid production from L-arabinose NBRC 102163T→ThemeOf→acid production from L-arabinose acid production from L-arabinose→ThemeOf→lactose NBRC→CauseOf→lactose NBRC 102163T→ThemeOf→lactose acid production from L-arabinose→CauseOf→NBRC NBRC→CauseOf→rhamnose NBRC 102163T→ThemeOf→rhamnose acid production from L-arabinose→ThemeOf→rhamnose rhamnose→ThemeOf→NBRC 102163T mannitol→ThemeOf→NBRC 102163T lactose→ThemeOf→NBRC 102163T rhamnose→ThemeOf→mannitol mannitol→ThemeOf→acid production from L-arabinose lactose→ThemeOf→mannitol rhamnose→ThemeOf→acid production from L-arabinose mannitol→ThemeOf→lactose lactose→ThemeOf→acid production from L-arabinose rhamnose→ThemeOf→lactose mannitol→CauseOf→NBRC lactose→CauseOf→NBRC rhamnose→CauseOf→NBRC
16	21603260	453	on the basis of the results of 16S rDNA phylogenetic analyses, the genus Weissella encompasses a phylogenetically coherent group of lactic acid bacteria and includes twelve validated Leuconostoc-like species, currently, including W. confusa (formerly Lactobacillus confusus), W. minor (formerly Lactobacillus minor), W. kandleri (formerly Lactobacillus kandleri), W. halotolerans (formerly Lactobacillus halotolerans), W. viridescens (formerly Lactobacillus viridescens), Weissella paramesenteroides (formerly Leuconostoc paramesenteroides), W. hellenica, W. thailandensis, W. cibaria, Weissella kimchii, Weissella soil, and Weissella koreensis.	Weissella→CauseOf→genus Weissella genus Weissella→CauseOf→Weissella
17	21995520	589	This was far higher than cellobiose, the other beta-glucoside tested, although the final pH of both cultures was very similar, and the medium was buffered in the same way as MRS. A high-quality draft genome sequence was generated for L. ruminis ATCC 25644 and a finished genome sequence was generated for ATCC 27782, as described in Methods.	ATCC 25644→ThemeOf→MRS MRS→ThemeOf→ATCC 25644
18	21995520	606	The amino acid sequence of BglB and BglB2 showed 70% and 77% identity to the beta-glucosidases identified in the genomes of L. helveticus DPC 4571 and L. ultunensis DSM 16047, respectively.	BglB2→ThemeOf→DPC BglB→ThemeOf→DPC DPC→ThemeOf→BglB DPC→ThemeOf→BglB2
19	21995520	649	The bovine L. ruminis isolates, ATCC 27780T, 27781 and 27782 were previously reported to utilise beta-glucan hydrolysates as a carbohydrate source, and in that study, all bovine isolates utilised beta-glucan hydrolysates of DP3, and only ATCC 27780T was unable to utilise DP4 oligosaccharide.	ATCC→CauseOf→DP3 ATCC→CauseOf→utilised utilised→CauseOf→ATCC DP3→CauseOf→ATCC
20	21995520	650	ATCC 27781 was distinguished by being able to utilise the highest percentage of both DP3 and DP4 beta glucan.	DP3→ThemeOf→ATCC DP4→ThemeOf→ATCC ATCC→ThemeOf→DP3 ATCC→ThemeOf→DP4
21	21995520	655	In addition, L. ruminis was capable of moderate to strong fermentation of Raftilose Synergy 1, an oligofructose-enriched inulin.	fermentation→ThemeOf→Raftilose Raftilose→ThemeOf→fermentation
22	21995520	684	The Artemis program was used to visualise and identify carbohydrate metabolism genes in the genome of Lactobacillus ruminis ATCC 25644 and ATCC 27782.	ATCC→CauseOf→carbohydrate metabolism genes carbohydrate metabolism genes→CauseOf→ATCC
23	22515692	10120	cremoris, Leuconostoc pseudomesenteroides, Pediococcus acidilactici, Pediococcus pentosaceus, Weissella hellenica, Weissella paramesenteroides and Carnobacterium divergens.	Leuconostoc pseudomesenteroides→CauseOf→Weissella Leuconostoc pseudomesenteroides→CauseOf→Weissella Weissella→CauseOf→Leuconostoc pseudomesenteroides Weissella→ThemeOf→Pediococcus Weissella→CauseOf→Leuconostoc pseudomesenteroides Weissella→ThemeOf→Pediococcus Pediococcus→ThemeOf→Weissella Pediococcus→ThemeOf→Weissella
24	22768237	728	The genes pox, orf2 and the sequence of insertion IS1297 exhibited DNA sequence identity percentages higher than 90% with genes found in Lactobacillus buchneri, Enterococcus faecalis and Leuconostoc sp., respectively (Table S3).	DNA sequence identity→ThemeOf→orf2 insertion→ThemeOf→Leuconostoc insertion→ThemeOf→pox Leuconostoc→ThemeOf→DNA sequence identity insertion→ThemeOf→DNA sequence identity Leuconostoc→ThemeOf→insertion insertion→ThemeOf→orf2 pox→ThemeOf→DNA sequence identity orf2→ThemeOf→DNA sequence identity pox→ThemeOf→insertion orf2→ThemeOf→insertion DNA sequence identity→ThemeOf→Leuconostoc DNA sequence identity→ThemeOf→pox DNA sequence identity→ThemeOf→insertion
25	22768237	731	Plasmid pGL2 appears to be a RCR plasmid, as suggested by the homology of its replication gene to those of other known RCR plasmids, such as pWCFS102 of Lactobacillus plantarum, pYSI8 of Lactobacillus sakei (Figure 3) and pSSU1 of Streptococcus suis , all members of the rolling-circle replication pMV158 family.	pGL2→ThemeOf→pYSI8 pWCFS102→ThemeOf→pGL2 pYSI8→ThemeOf→pGL2 pGL2→ThemeOf→pWCFS102
26	22768237	744	The protein encoded by orf16 displayed 42% aa identity to N-acetylmuramoyl-L-alanine amidase of Streptococcus dysgalactiae and contains two main enzymatic domains: a glucosaminidase domain (pfam01832) and a cysteine/histidine-dependant amidohydrolase/peptidase (designated CHAP; pfam05257) domain.	pfam01832→ThemeOf→orf16 orf16→ThemeOf→pfam01832
27	22768237	753	Txn of L. garvieae exhibits the catalytic Glu-X-Glu sequence (residues 199 to 201 in Txn), the NAD binding sites Ser-Thr-Ser sequence (amino acids 156-158 in Txn) and a conserved Arg residue (residing at position 129 in Txn), characteristic of the CT-group of many mono-ADP-ribosyltransferases.	Arg→ThemeOf→Txn Txn→ThemeOf→Glu-X-Glu Arg→ThemeOf→Txn Arg→ThemeOf→Glu-X-Glu Txn→ThemeOf→Arg Arg→ThemeOf→Txn Txn→ThemeOf→Glu-X-Glu Glu-X-Glu→ThemeOf→Txn Txn→ThemeOf→Arg Glu-X-Glu→ThemeOf→Txn Txn→ThemeOf→Glu-X-Glu Glu-X-Glu→ThemeOf→Txn Txn→ThemeOf→Arg Glu-X-Glu→ThemeOf→Arg Txn→ThemeOf→Glu-X-Glu Glu-X-Glu→ThemeOf→Txn Arg→ThemeOf→Txn Txn→ThemeOf→Arg
28	22808200	768	Transcriptome analysis revealed that motility genes were transcribed at a significantly higher level in motile L. ruminis ATCC27782 than in non-motile ATCC25644.	ATCC27782→ThemeOf→transcribed ATCC27782→CauseOf→higher motility→ThemeOf→transcribed motility→ThemeOf→ATCC27782 motility→ThemeOf→higher transcribed→ThemeOf→motility transcribed→ThemeOf→ATCC27782 transcribed→ThemeOf→higher ATCC27782→ThemeOf→motility
29	22808200	777	Particular substitutions within this region enable selected flagellate alpha- and epsilon-proteobacterial pathogens, including H. pylori and C. jejuni, to evade immune-recognition without compromising their motility.	flagellate→ThemeOf→enable evade immune-recognition→ThemeOf→substitutions evade immune-recognition→ThemeOf→enable evade immune-recognition→ThemeOf→flagellate substitutions→ThemeOf→evade immune-recognition substitutions→CauseOf→enable substitutions→ThemeOf→flagellate flagellate→ThemeOf→evade immune-recognition flagellate→ThemeOf→substitutions
30	22808200	789	Three other species of the L. salivarius clade tested, specifically L. ghanensis L489T, L. mali DSM20444T and L. nagelii DSM13675T were also motile.	L. nagelii→ThemeOf→motile L489T→ThemeOf→motile L. mali DSM20444T→ThemeOf→motile motile→ThemeOf→L. nagelii motile→ThemeOf→L489T motile→ThemeOf→L. mali DSM20444T motile→ThemeOf→DSM20444T DSM20444T→ThemeOf→motile
31	22808200	792	Relative to the L. ruminis motility locus, other notable variations in the L. mali motility region include the inversion of the motAB gene pair, the absence of homologs for flaG and a potential negative regulator (LRC_15730/ANHS_518; see below) of motility gene expression and the presence of only one flagellin gene in a strain that is known to be motile.	inversion→ThemeOf→absence motility→ThemeOf→inversion inversion→ThemeOf→presence motility→ThemeOf→motAB inversion→ThemeOf→motility motility→ThemeOf→absence inversion→ThemeOf→LRC_15730 motility→ThemeOf→presence motAB→ThemeOf→inversion motility→ThemeOf→LRC_15730 motAB→ThemeOf→absence LRC_15730→ThemeOf→inversion motAB→ThemeOf→presence LRC_15730→ThemeOf→absence motAB→ThemeOf→motility LRC_15730→ThemeOf→presence absence→ThemeOf→presence LRC_15730→ThemeOf→motility inversion→ThemeOf→motAB presence→ThemeOf→absence
32	22808200	803	To determine if L. ruminis ATCC25644 might regain motility in vivo, isogenic, rifampicin resistant ATCC25644 and ATCC27782 strains were individually fed to mice and were later recovered from their faeces.	ATCC25644→ThemeOf→ATCC25644 motility→ThemeOf→regain ATCC25644→ThemeOf→motility motility→ThemeOf→ATCC27782 ATCC27782→ThemeOf→regain motility→CauseOf→ATCC25644 ATCC27782→ThemeOf→ATCC25644 ATCC27782→ThemeOf→motility ATCC25644→ThemeOf→ATCC25644 ATCC25644→CauseOf→regain ATCC25644→ThemeOf→ATCC27782 ATCC25644→CauseOf→motility ATCC25644→ThemeOf→regain motility→ThemeOf→ATCC25644
33	22808200	820	The following substitutions were made to prepare MRS media (500 ml) with alternative protein, phosphate and carbon sources: 9 g of Bactocasitone or Bactopeptone in place of peptone (5 g) and Lab Lemco powder (4 g); 1 g of beta-glycerophosphate in place of dipotassium hydrogen phosphate; 10 g of preferred carbohydrate in place of glucose.	Bactocasitone→ThemeOf→preferred carbohydrate preferred carbohydrate→ThemeOf→Bactocasitone
34	22808200	837	Primer sequences were designed for groEL, fliM and LRC_15730 (Table S5).	LRC_15730→ThemeOf→groEL groEL→ThemeOf→LRC_15730
35	22808200	839	Rifampicin-resistant L. ruminis ATCC25644 and L. ruminis ATCC27782 variants were produced by serially subculturing these strains in MRS media with increasing concentrations of rifampicin until bacteria resistant to 200 microg/ml rifampicin were recovered.	ATCC27782→ThemeOf→variants variants→ThemeOf→ATCC27782
36	23443163	860	Different sets of target strains were used including common indicator strains employed by different laboratories in similar studies (e.g., Lactococcus lactis CNRZ 117, Lactobacillus sakei LMG 2313, Listeria innocua BL86/26, etc.	LMG→ThemeOf→Listeria Listeria→ThemeOf→LMG
37	23443163	866	More precisely, the milk CFCS of L. lactis, as well as the MRS CFCSs of both E. faecium strains gave a "borderline" inhibition (i.e., less colonies of the target strain around the well) towards Porphyromonas gingivalis DSM 20709T.	DSM 20709T→ThemeOf→Porphyromonas gingivalis DSM 20709T→CauseOf→less Porphyromonas gingivalis→ThemeOf→less Porphyromonas gingivalis→ThemeOf→DSM 20709T colonies→ThemeOf→Porphyromonas gingivalis Porphyromonas gingivalis→ThemeOf→colonies
38	23443163	868	More specifically, the MRS CFCS of L. fermentum ACA-DC 179 and milk CFCS of L. plantarum ACA-DC 269 were active against S. oralis LMG 14532T.	LMG→CauseOf→active
39	23637931	977	The most abundant Lactobacillus species in ZC2 were L. brevis (26.5%), L. plantarum (3.4%), L. oris (3.4%), L. johnsonii (3.3%), L. amylovorus (3.2%), and L. fermentum (2.8%).	Lactobacillus→ThemeOf→ZC2 L. johnsonii→ThemeOf→ZC2 L. johnsonii→ThemeOf→Lactobacillus ZC2→ThemeOf→L. johnsonii ZC2→ThemeOf→Lactobacillus Lactobacillus→ThemeOf→L. johnsonii
40	23637931	986	For instance, some of the abundant COG functions in ZC1 and/or ZC2 (Table 3), such as hydrolases and dehydrogenases (COG1012, COG1960, COG1028, COG0673 and COG0561) and proteins involved with carbohydrate transport and metabolism (COG0395, COG1175, COG1129, COG1109, COG2814 and COG2723), can be related directly to the dynamics and recycling power in the microbial community structure in a biomass degrading environment.	COG0395→ThemeOf→ZC2 COG1028→ThemeOf→ZC2 COG1012→ThemeOf→ZC2 ZC2→ThemeOf→COG0395 ZC2→ThemeOf→COG1028 ZC2→ThemeOf→COG1012 ZC2→ThemeOf→COG0673 COG0673→ThemeOf→ZC2
41	23637931	987	In addition, among the most abundant functions present in ZC1 and/or ZC2 metagenomes (Table 3), we found several COGs associated with bacterial efflux pumps (COG1132, COG0841, COG0534, COG1131 and COG1136), which are known to export substances such as antibiotics and toxic molecules.	COG1132→CauseOf→associated COG1136→CauseOf→associated COG1131→CauseOf→associated COG0534→CauseOf→associated COG0841→CauseOf→associated
42	23637931	989	The 30 most abundant COG functions (Table 3) also include functions related to regulation in response to environmental stimuli such as histidine kinases and response regulators (COG0642 and COG0745) and transcriptional regulators (COG1609 and COG0583).	histidine→ThemeOf→COG1609 COG0642→ThemeOf→regulation COG0642→ThemeOf→histidine COG1609→ThemeOf→regulation COG1609→ThemeOf→histidine regulation→ThemeOf→histidine regulation→ThemeOf→COG0642 regulation→ThemeOf→COG1609 histidine→ThemeOf→regulation histidine→ThemeOf→COG0642
43	23637931	995	In addition, we were able to identify 65 predicted protein sequences containing the dockerin domain (pfam00404) and 36 predicted protein sequences with the cohesin domain (pfam00963) in the ZC1 metagenome.	ZC1→ThemeOf→pfam00404 dockerin→ThemeOf→pfam00404 dockerin→ThemeOf→ZC1 pfam00404→ThemeOf→dockerin pfam00404→ThemeOf→ZC1 ZC1→ThemeOf→dockerin
44	23637931	1024	Among these overrepresented COGs are those associated with bacterial efflux pumps (COG 1132 and COG0534), which are abundant within the ZC1 and ZC2 metagenomes, as already noted above.	associated→CauseOf→overrepresented COG→CauseOf→associated COG→CauseOf→overrepresented overrepresented→CauseOf→associated COG0534→CauseOf→associated COG0534→CauseOf→overrepresented
45	23637931	1026	Also, predicted genes related to phosphotransferase system (COG1455, COG1263 and COG1264) and to ABC-type transport systems (Table S6) are overrepresented in the ZC2 metagenome, revealing its high potential for sugar uptake.	phosphotransferase system→ThemeOf→overrepresented phosphotransferase system→ThemeOf→ZC2 COG1455→ThemeOf→phosphotransferase system COG1455→CauseOf→overrepresented COG1455→ThemeOf→ZC2 ZC2→ThemeOf→phosphotransferase system ZC2→ThemeOf→COG1455 ZC2→ThemeOf→overrepresented phosphotransferase system→ThemeOf→COG1455
46	23661478	1063	L. pobuzihii E100301T can produce l-lactic acid from l-arabinose, rhamnose, lactose, and 5-ketogluconate, but not from mannitol.	E100301T→CauseOf→produce E100301T→ThemeOf→l-lactic acid l-lactic acid→ThemeOf→produce l-lactic acid→ThemeOf→E100301T
47	23700436	1084	In this setting, Lu-doh-huang is used for its antipyretic and diuretic effects and for detoxification, reduction of swelling, and gut decontamination as empiric treatment.	Lu-doh-huang→CauseOf→reduction
48	23700436	1085	In addition, Lu-doh-huang induces apoptosis of Hep3B hepatoma cells, reduces inflammation in lipopolysaccharide-induced RAW264.7 cells, and has antioxidative properties.	hepatoma→ThemeOf→Lu-doh-huang Lu-doh-huang→ThemeOf→inflammation hepatoma→ThemeOf→induces Lu-doh-huang→CauseOf→reduces Lu-doh-huang→CauseOf→induces Lu-doh-huang→ThemeOf→antioxidative induces→CauseOf→reduces inflammation→ThemeOf→Lu-doh-huang inflammation→ThemeOf→induces antioxidative→ThemeOf→reduces reduces→CauseOf→induces antioxidative→ThemeOf→Lu-doh-huang Lu-doh-huang→ThemeOf→hepatoma antioxidative→ThemeOf→induces
49	23700436	1086	In animal models, Lu-doh-huang exerts a protective effect on CCl4-induced hepatotoxicity in rats; induces the activities of NADPH-CYP reductase, glutathione S-transferase, superoxide dismutase, glutathione peroxidase, and catalase in Balb/c mice; significantly decreases plasma glucose, total cholesterol, and triglycerides; and inhibits tyrosinase activity in MDCK and A375 cells.	Lu-doh-huang→CauseOf→induces Lu-doh-huang→CauseOf→inhibits Lu-doh-huang→CauseOf→decreases
50	23700436	1135	In addition, we performed PCA to characterize the microbial community succession of Lu-doh-huang (Fig.	Lu-doh-huang→ThemeOf→microbial community succession microbial community succession→ThemeOf→Lu-doh-huang
51	23700436	1154	A key difference between these products is the type of fermentation used in their manufacture, that is, Lu-doh-huang undergoes strictly anaerobic fermentation (inside bamboo sections), whereas the production of Semen Sojae Praeparatum involves aerobic fermentation.	Lu-doh-huang→CauseOf→undergoes
52	23700436	1162	Therefore, we speculate that the main purpose of the unique production process of Lu-doh-huang is to enable microbial enzymes secreted during fermentation to biotransform various components of the product.	biotransform→ThemeOf→enable biotransform→ThemeOf→Lu-doh-huang Lu-doh-huang→ThemeOf→biotransform Lu-doh-huang→CauseOf→enable
53	24936378	1184	The molecular method used failed to determine the exact taxonomic status of BH0900 and AH3133.	BH0900→ThemeOf→AH3133 AH3133→ThemeOf→BH0900
54	24936378	1223	However, it was observed that Pseudomonas aeruginosa ATCC 27853 resisted the inhibitory potential as compared with the other indicator bacteria (Fig.	ATCC 27853→CauseOf→resisted
55	24936378	1245	Furthermore, L-arabinose, D-xylose, D-mannose, mannitol, lactose, B-gentiobiose, maltose and saccharose were variously fermented.	D-mannose→ThemeOf→L-arabinose mannitol→ThemeOf→L-arabinose D-mannose→ThemeOf→D-xylose mannitol→ThemeOf→D-xylose D-mannose→ThemeOf→mannitol L-arabinose→ThemeOf→D-mannose L-arabinose→ThemeOf→D-xylose L-arabinose→ThemeOf→mannitol D-xylose→ThemeOf→D-mannose D-xylose→ThemeOf→L-arabinose D-xylose→ThemeOf→mannitol mannitol→ThemeOf→D-mannose
56	24936378	1247	Cluster F), this cluster contained four strains of Lactobacillus sp., BH1611, BH1711, BH181 and BH1911.	Lactobacillus→ThemeOf→BH1711 Lactobacillus→ThemeOf→BH1611 BH1711→ThemeOf→Lactobacillus BH1711→ThemeOf→BH1611 BH1611→ThemeOf→Lactobacillus BH1611→ThemeOf→BH1711
57	24936378	1261	However, strain BH2422 (cluster H) was also unable to ferment D-arabinose.	ferment D-arabinose→ThemeOf→BH2422 ferment D-arabinose→ThemeOf→unable BH2422→CauseOf→unable BH2422→ThemeOf→ferment D-arabinose
58	24936378	1292	BH2122) inhibits strongly E. coli, Salmonella typhimurium and moderately inhibits Pseudomonas aeruginosa but is inactive towards Shigella sp.	Salmonella→ThemeOf→inhibits BH2122→CauseOf→inhibits inhibits→CauseOf→inhibits inhibits→CauseOf→inhibits E. coli→ThemeOf→Salmonella Pseudomonas→ThemeOf→Salmonella E. coli→ThemeOf→inhibits Pseudomonas→ThemeOf→inhibits E. coli→ThemeOf→BH2122 Pseudomonas→ThemeOf→BH2122 E. coli→ThemeOf→inhibits Pseudomonas→ThemeOf→inhibits Salmonella→ThemeOf→E. coli BH2122→ThemeOf→E. coli Salmonella→ThemeOf→inhibits BH2122→ThemeOf→Salmonella Salmonella→ThemeOf→Pseudomonas BH2122→CauseOf→inhibits Salmonella→ThemeOf→BH2122 BH2122→ThemeOf→Pseudomonas
59	24936378	1301	Overall, all isolates fermented maltose and cellobiose except Pediococcus acidilactici AH5255 (cluster E) and Pediococcus pentosaceus AH3433, AH3433A, AH3433B, AH3433C, AH3433D and AH3433E (cluster I).	fermented→ThemeOf→AH3433C fermented→ThemeOf→AH3433B AH3433E→ThemeOf→fermented fermented→ThemeOf→AH3433A AH3433→CauseOf→fermented fermented→ThemeOf→AH5255 AH3433D→ThemeOf→fermented AH3433A→ThemeOf→fermented AH3433C→ThemeOf→fermented AH5255→ThemeOf→fermented AH3433B→ThemeOf→fermented fermented→ThemeOf→AH3433E fermented→CauseOf→AH3433 fermented→ThemeOf→AH3433D
60	24942190	4171	Amongst the subfamily of MOBV1 plasmids, three groups of oriT sequences, represented by plasmids pMV158, pT181, and p1414 were identified.	pT181→ThemeOf→pMV158 MOBV1→ThemeOf→pMV158 pMV158→ThemeOf→pT181 pMV158→ThemeOf→MOBV1
61	24942190	4200	The nick introduced by Rep or Tra/Mob proteins generates a free 3'-OH end, which acts as a primer for leading-strand synthesis in both cases, VGT and HGT.	HGT→ThemeOf→VGT VGT→ThemeOf→HGT VGT→ThemeOf→Rep Rep→ThemeOf→VGT
62	24942190	4219	Although we have not performed any further search, a homolog of the pMV158-tetL determinant was found in the chromosome of Bacillus subtilis, whereas a cat gene, homologous to the one harbored by plasmids pC194 and pC221 has been described to be present in the chromosome of G+ bacteria, like Bacillus pumilus or Streptococcus pneumoniae, and even in the chromosome of Clostridium perfringens.	pC221→CauseOf→found
63	24942190	4224	In vitro, the MobM-protein from pMV158 was able to relax supercoiled DNA from both plasmids.	pMV158→ThemeOf→MobM-protein MobM-protein→ThemeOf→pMV158
64	24942190	4229	In general, we found a good correlation between the G + C content of RCR-plasmids and their respective hosts, with the exception of the staphylococcal plasmid pUB110 which has a G + C content close to 45%, making it a plasmid which has been considered more like a bacilli than a staphylococci replicon.	G + C→ThemeOf→pUB110 G + C content→ThemeOf→pUB110 G + C content→ThemeOf→G + C pUB110→ThemeOf→G + C content pUB110→ThemeOf→G + C G + C→ThemeOf→G + C content
65	24942190	4245	It was believed that plasmids are DNA molecules that result from shuffling of various gene cassettes, evolving independently one of each other.	shuffling→CauseOf→result
66	24942190	4252	A total of 97 sequences were manually identified upstream to their respective relaxase encoded genes (five of them exhibiting two different MOBV-related oriTs: pSTE1, pKKS285, pSCFS1, unnamed (GenBank Acc.	pSCFS1→ThemeOf→pKKS285 pKKS285→ThemeOf→pSCFS1 pKKS285→ThemeOf→pSTE1 pSTE1→ThemeOf→pKKS285
67	24942190	4260	It is more intriguing the finding that pC194 and DeltaoriT-Deltamob-derivatives of plasmids pUB110 and pTA1060 were efficiently mobilized by the mating apparatus of ICEBs1, but without the intervention of the ICEBs1 NicK relaxase.	pC194→ThemeOf→pTA1060 pTA1060→ThemeOf→pC194
68	24942190	4280	Eight mating-pair formation (MPF) types have been phylogenetically described; three of them, MPFFATA, MPFFA and MPFT were able to mobilize MOBV1 plasmids.	mobilize MOBV1 plasmids→ThemeOf→MPFT mobilize MOBV1 plasmids→ThemeOf→MPFFATA MPFT→ThemeOf→mobilize MOBV1 plasmids MPFT→ThemeOf→MPFFATA MPFFATA→ThemeOf→mobilize MOBV1 plasmids MPFFATA→ThemeOf→MPFT
69	24942190	4283	MOBV1 relaxases are predominantly linked to RCR initiators of the three different subgroups: Rep_1 (PF01446), Rep_2 (PF01719), and Rep_trans (PF02486).	Rep→ThemeOf→linked PF01446→ThemeOf→MOBV1 Rep→ThemeOf→PF01446 PF01446→CauseOf→linked Rep→ThemeOf→PF01719 MOBV1→ThemeOf→PF01446 Rep→ThemeOf→linked MOBV1→ThemeOf→PF01719 Rep→ThemeOf→PF01446 MOBV1→ThemeOf→linked Rep→ThemeOf→PF01719 PF01719→ThemeOf→Rep Rep→ThemeOf→linked PF01719→ThemeOf→Rep PF01446→ThemeOf→Rep PF01719→ThemeOf→Rep Rep→ThemeOf→PF01446 PF01446→ThemeOf→Rep PF01719→ThemeOf→MOBV1 Rep→ThemeOf→PF01719 PF01446→ThemeOf→Rep PF01719→CauseOf→linked
70	24942190	4304	Deletion of the region encompassing the ssoA led to accumulation of ssDNA intermediates and to plasmid instability, but the plasmids were still able to replicate.	plasmid instability→ThemeOf→ssDNA intermediates plasmid instability→ThemeOf→Deletion plasmid instability→ThemeOf→accumulation ssDNA intermediates→ThemeOf→plasmid instability ssDNA intermediates→ThemeOf→Deletion ssDNA intermediates→ThemeOf→accumulation Deletion→ThemeOf→plasmid instability Deletion→ThemeOf→ssDNA intermediates Deletion→CauseOf→accumulation
71	25501479	10134	Moreover, the presence of a large number of mobile genetic elements within and flanking the motility operon of L. curvatus suggests recent horizontal transfer between members of two distinct Lactobacillus clades: L. acidipiscis in the L. salivarius clade and L. curvatus inthe L. sakei clade.	L. acidipiscis→CauseOf→horizontal L. acidipiscis→ThemeOf→motility motility→ThemeOf→horizontal motility→ThemeOf→L. acidipiscis
72	25584532	1350	Apart from mobC and rlx coding for mobilization proteins, two additional genes (SMA_p0016 and SMA_p0017) encode a conserved hypothetical protein and a Fic family protein, respectively.	SMA_p0017→ThemeOf→Fic Fic→ThemeOf→SMA_p0017 Fic→ThemeOf→SMA_p0016 SMA_p0016→ThemeOf→Fic
73	25584532	1352	We found a 2.5 kb region within a large genomic island of S. macedonicus ACA-DC 198 containing genes SMA_0309 and SMA_0310 that showed >= 98% identity with cadC and cadA of pAH82.	cadA→ThemeOf→SMA_0309 cadA→ThemeOf→SMA_0310 SMA_0309→ThemeOf→cadA SMA_0310→ThemeOf→cadA
74	25918672	1510	Variants of the L. acidipiscis and L. rennini, represented by bands "h" and "k", respectively, were also detected in the product made in northeastern Thailand (lane 6).	L. acidipiscis→ThemeOf→Variants Variants→ThemeOf→L. acidipiscis Variants→ThemeOf→L. rennini L. rennini→ThemeOf→Variants
75	26415554	1605	Fucose residues are present in oligosaccharides in milk and on erythrocyte surface antigens.	Fucose→CauseOf→present
76	26415554	1614	A major class of surface proteins in Gram-positive bacteria are those anchored by sortase enzymes that recognize a highly conserved LPXTG sequence motif.	sortase→ThemeOf→LPXTG LPXTG→ThemeOf→sortase
77	26415554	1646	16) including widespread IS families (IS3 is nearly universal), as well as sequences that selectively occur in particular niches (for example, IS91 in dairy L. casei and L. paracasei tolerans and IS481 in brewing L. paracollinoides, L. farraginis and P. inopinatus).	IS91→CauseOf→occur IS481→CauseOf→occur
78	26415554	1684	These searches included the DUF1034, which is equivalent to the Fn1 domain of ScpA; the CHU_C model corresponding to the Fn2 domain; the PA domain; SLAP, which is an S layer-anchoring domain; and a manual inspection for LPXTG derivative sequence.	DUF1034→ThemeOf→ScpA CHU→ThemeOf→ScpA CHU→ThemeOf→DUF1034 ScpA→ThemeOf→CHU ScpA→ThemeOf→DUF1034 DUF1034→ThemeOf→CHU
79	26783070	10138	L. plantarum showed a mucin adhesion rate similar to that of L. plantarum 299v and L. casei Shirota, while L. pentosus and L. acidipiscis had a lower mucin adhesion.	mucin adhesion→ThemeOf→lower L. acidipiscis→ThemeOf→mucin adhesion L. acidipiscis→ThemeOf→mucin adhesion L. acidipiscis→CauseOf→lower mucin adhesion→ThemeOf→L. acidipiscis mucin adhesion→ThemeOf→mucin adhesion mucin adhesion→ThemeOf→lower mucin adhesion→ThemeOf→L. acidipiscis mucin adhesion→ThemeOf→mucin adhesion
80	26783070	10141	This is the first time that halotolerant lactic acid bacteria have been shown to have probiotic properties.	halotolerant→ThemeOf→probiotic halotolerant→ThemeOf→lactic probiotic→ThemeOf→halotolerant probiotic→ThemeOf→lactic lactic→ThemeOf→halotolerant lactic→ThemeOf→probiotic
81	27743669	10147	Based on morphological and biochemical characteristics, and 16S rRNA gene sequence analysis, natural strains from both grasses were identified as L. plantarum, L. casei, Lactobacillus acidipiscis, Leuconostoc pseudomesenteroides, Leuconostoc garlicum, Weissella confusa, and Lactococcus lactis.	Weissella→ThemeOf→Leuconostoc Leuconostoc→ThemeOf→Lactococcus Leuconostoc→ThemeOf→Weissella Lactococcus→ThemeOf→Weissella Lactococcus→ThemeOf→Leuconostoc Weissella→ThemeOf→Lactococcus
82	28028487	1726	This was an alternative procedure owing to the poor performance of pick_closed_otus.py, which reduced the overall number of OTUs in the cockatiel samples (Supplemental Information 1).	number→ThemeOf→reduced number→ThemeOf→pick_closed_otus.py pick_closed_otus.py→CauseOf→reduced pick_closed_otus.py→ThemeOf→number
83	28028487	1748	The most common species (as best BLAST hits) for cockatiels are Lactobacillus coleohominis, L. reuteri and L. acidipiscis.	L. reuteri→ThemeOf→Lactobacillus L. acidipiscis→ThemeOf→Lactobacillus Lactobacillus→ThemeOf→L. reuteri Lactobacillus→ThemeOf→L. acidipiscis
84	28261168	1901	This implies that co-existence of gadA and gadB in Lb.	gadB→ThemeOf→gadA gadA→ThemeOf→gadB
85	28261168	1952	brevis GadA (WT) exhibited a significant (p < 0.05) activity than its two mutants with modifications to its N-terminus (Figure 4D).	modifications→ThemeOf→activity activity→ThemeOf→modifications
86	28261168	1990	Moreover, transmembrane potential, which contributes to amino acid-dependent acid resistance in bacteria, could be increased by glutamate decarboxylation (Teixeira et al.,).	glutamate decarboxylation→CauseOf→increased glutamate decarboxylation→ThemeOf→transmembrane potential glutamate decarboxylation→ThemeOf→amino acid-dependent acid resistance transmembrane potential→ThemeOf→increased amino acid-dependent acid resistance→ThemeOf→increased transmembrane potential→ThemeOf→decarboxylation amino acid-dependent acid resistance→ThemeOf→transmembrane potential transmembrane potential→ThemeOf→glutamate decarboxylation amino acid-dependent acid resistance→ThemeOf→decarboxylation transmembrane potential→ThemeOf→amino acid-dependent acid resistance amino acid-dependent acid resistance→ThemeOf→glutamate decarboxylation decarboxylation→CauseOf→increased decarboxylation→ThemeOf→transmembrane potential decarboxylation→ThemeOf→amino acid-dependent acid resistance
87	28261168	1996	brevis GadB demonstrated that these mutants extended their activities toward near-neutral acidity (Yu et al.,; Shi et al.,).	mutants→ThemeOf→activities toward near-neutral acidity mutants→CauseOf→extended mutants→ThemeOf→GadB GadB→ThemeOf→activities toward near-neutral acidity GadB→ThemeOf→extended GadB→ThemeOf→mutants activities toward near-neutral acidity→ThemeOf→extended activities toward near-neutral acidity→ThemeOf→mutants activities toward near-neutral acidity→ThemeOf→GadB
88	28390025	10168	In addition, the Fourier transform infrared spectrophotometer data showed that functional groups such as C-H, O-H, C=O, and C-O-C which possibly associated with Pb2+ binding were mainly presented in the suspended solid portion of IC.	C-O-C→CauseOf→associated C-O-C→CauseOf→presented associated→CauseOf→presented presented→CauseOf→associated
89	28399167	2033	Biochemically, the E. sibiricum 255-15 GtfC is very similar to L. reuteri GtfB, both cleaving (alpha1 4) linkages and introducing (alpha1 6) linkages in linear chains.	GtfC→ThemeOf→introducing GtfC→ThemeOf→alpha1 6 GtfC→ThemeOf→cleaving alpha1 6→ThemeOf→introducing alpha1 6→ThemeOf→GtfC alpha1 6→ThemeOf→cleaving alpha1 4) linkages→ThemeOf→introducing cleaving→ThemeOf→alpha1 4) linkages alpha1 4) linkages→ThemeOf→GtfC cleaving→CauseOf→introducing alpha1 4) linkages→ThemeOf→cleaving cleaving→ThemeOf→GtfC GtfC→ThemeOf→alpha1 4) linkages cleaving→ThemeOf→alpha1 6
90	28399167	2039	Instead of forming linear (alpha1 6) glucan chains, this enzyme was found to convert amylose into a branched and high molecular mass alpha-glucan with alternating (alpha1 4) and (alpha1 6) linkages.	alpha1 6) linkages→CauseOf→convert alpha1 6) linkages→ThemeOf→amylose alpha1 4→CauseOf→convert alpha1 4→ThemeOf→amylose amylose→ThemeOf→alpha1 6) linkages amylose→ThemeOf→alpha1 4 amylose→ThemeOf→convert
91	28399167	2052	The PCR primers used for amplifying the gtfD gene incorporated 5' extensions (in bold) to facilitate the ligation-independent (LIC) cloning and were: PbF (5 ' CAGGGACCCGGTGCGGAAAGCAATGCGAAAGG 3') and PbR (5 ' CGAGGAGAAGCCCGGTTAATTGCTAAACCGTCTTAATGCTTTATTC 3').	gtfD→ThemeOf→PbR PbR→ThemeOf→gtfD
92	28399167	2078	One-dimensional 500-MHz 1H NMR spectra were recorded at a 4 000 Hz spectral width and 16k complex points, using a WET1D pulse to suppress the HOD signal.	WET1D→ThemeOf→HOD signal HOD signal→ThemeOf→suppress HOD signal→ThemeOf→WET1D WET1D→CauseOf→suppress
93	28399167	2148	In accordance with its non-permuted domain organization, the order of these four conserved regions in P. beijingensis GtfD and other GtfD-like proteins is I-II-III-IV, instead of the permuted order II-III-IV-I characteristic of GH70 glucansucrases and GtfB-like 4,6-alpha-GTases.	GtfD→ThemeOf→I-II-III-IV GtfB-like→ThemeOf→I-II-III-IV GH70→ThemeOf→I-II-III-IV I-II-III-IV→ThemeOf→GtfD I-II-III-IV→ThemeOf→GtfB-like I-II-III-IV→ThemeOf→GH70
94	28399167	2149	Among these seven residues, the nucleophile, the general acid/base and the transition state stabilizer of the catalytic triad were identified as Asp409, Glu442 and Asp512 in P. beijingensis GtfD (P. beijingensis GtfD numbering is used throughout unless indicated otherwise), respectively.	GtfD→ThemeOf→Glu442 GtfD→ThemeOf→Asp512 Asp409→ThemeOf→GtfD Glu442→ThemeOf→GtfD Asp512→ThemeOf→GtfD GtfD→ThemeOf→Asp409
95	28399167	2152	Of note is the presence of a Tyr in GtfB, GtfC and GtfD proteins replacing the subsite +1/+2 Trp residue conserved in almost all GSs (W1065 in GTF180-DeltaN).	GtfC→ThemeOf→Tyr GtfD→ThemeOf→W1065 W1065→ThemeOf→GtfB GtfD→ThemeOf→Tyr W1065→ThemeOf→GtfC W1065→CauseOf→replacing W1065→ThemeOf→GtfD GtfB→ThemeOf→replacing Tyr→ThemeOf→GtfB GtfB→ThemeOf→W1065 Tyr→ThemeOf→GtfC GtfB→ThemeOf→Tyr Tyr→CauseOf→replacing GtfC→ThemeOf→replacing Tyr→ThemeOf→GtfD GtfC→ThemeOf→W1065 GtfD→ThemeOf→replacing
96	28399167	2153	A conserved Tyr is also present in the Lactobacillus fermentum GtfB active on (alpha1 4 glucans), but displaying (alpha1 3) linkage specificity suggesting that this residue may be considered a "sequence fingerprint" of GH70 proteins active on starch and maltodextrins.	GtfB→ThemeOf→Tyr Tyr→ThemeOf→GtfB
97	28399167	2209	After treatment with pullulanase, the P. beijingensis GtfD and the A. chroococcum GtfD products were degraded into smaller oligosaccharides, reflecting the presence of alternating (alpha1 6)/(alpha1 4), and (alpha1 4,6) branching points in these polymers.	degraded→CauseOf→presence presence→CauseOf→degraded alpha1 4,6→CauseOf→degraded alpha1 4,6→CauseOf→presence
98	28399167	2216	Compared with the A. chroococcum GtfD product the linear (alpha1 4)-linked sequences are longer in the P. beijingensis GtfD HMM polymer (up to DP6 in the model) and even longer in the P. beijingensis GtfD LMM polymer (up to DP8 in the model).	P. beijingensis→CauseOf→longer P. beijingensis→CauseOf→longer longer→CauseOf→longer longer→CauseOf→longer
99	28399167	2247	Whereas most of the digestible fraction of the A. chroococcum GtfD-treated starch was hydrolyzed to glucose after 20 min, the rate of hydrolysis for P. beijingensis GtfD-treated starch continually increased over the 120 min of simulated intestinal digestion.	GtfD-treated→ThemeOf→rate hydrolysis→ThemeOf→GtfD-treated hydrolysis→ThemeOf→increased rate→ThemeOf→GtfD-treated rate→ThemeOf→increased GtfD-treated→CauseOf→increased GtfD-treated→ThemeOf→hydrolysis
100	28399996	10174	In particular, esters, associated with fruity and floral notes, were positively correlated to L. paracollinoides, L. acidipiscis, and P. parvulus species.	L. acidipiscis→CauseOf→correlated
101	28414739	2339	Here, an effort was made to assess whether any variations in these cell surface-related proteins can define the ecological niche preference of each individual L. ruminis strain.	variations→CauseOf→define ecological niche preference→ThemeOf→define ecological niche preference→ThemeOf→variations variations→ThemeOf→ecological niche preference
102	28414739	2344	Here, it might be envisioned that active expression of the core gene annotated as fibronectin-binding protein (Fbp) (GRL1172_498, HMPREF0542_10570, LRC_RS05075, LRN_0851, PEL65_1842, PEL66_466, P869_04425, LRU_00261, and LRP_1613) might contribute to the gut autochthony of the various L. ruminis strains.	LRP_1613→ThemeOf→gut autochthony gut autochthony→ThemeOf→GRL1172_498 HMPREF0542_10570→CauseOf→contribute PEL65_1842→CauseOf→contribute gut autochthony→ThemeOf→PEL66_466 HMPREF0542_10570→ThemeOf→gut autochthony PEL65_1842→ThemeOf→gut autochthony gut autochthony→ThemeOf→LRP_1613 P869_04425→CauseOf→contribute LRN_0851→CauseOf→contribute gut autochthony→ThemeOf→PEL65_1842 P869_04425→ThemeOf→gut autochthony LRN_0851→ThemeOf→gut autochthony gut autochthony→ThemeOf→LRN_0851 GRL1172_498→CauseOf→contribute LRU_00261→CauseOf→contribute gut autochthony→ThemeOf→LRU_00261 GRL1172_498→ThemeOf→gut autochthony LRU_00261→ThemeOf→gut autochthony gut autochthony→ThemeOf→LRC_RS05075 PEL66_466→CauseOf→contribute gut autochthony→ThemeOf→contribute LRC_RS05075→CauseOf→contribute PEL66_466→ThemeOf→gut autochthony gut autochthony→ThemeOf→HMPREF0542_10570 LRC_RS05075→ThemeOf→gut autochthony LRP_1613→CauseOf→contribute gut autochthony→ThemeOf→P869_04425
103	28414739	2364	Further, we noticed that this shortened LrpB primary structure results from an insertion of two adenines along the lrpB coding sequence, thus producing a reading-frameshift change.	lrpB→ThemeOf→producing LrpB→ThemeOf→reading-frameshift change lrpB→ThemeOf→insertion LrpB→ThemeOf→producing reading-frameshift change→ThemeOf→lrpB LrpB→ThemeOf→insertion reading-frameshift change→ThemeOf→producing reading-frameshift change→ThemeOf→insertion reading-frameshift change→ThemeOf→LrpB insertion→ThemeOf→lrpB insertion→ThemeOf→reading-frameshift change insertion→CauseOf→producing lrpB→ThemeOf→reading-frameshift change insertion→ThemeOf→LrpB
104	28414739	2365	Relatedly, it is worth mentioning we had previously observed that for the DPC 6832-sourced LrpB pilin, there is a shift in the reading-frame of its deduced primary structure, which we found is due to a missing cytosine in a serine codon.	LrpB→ThemeOf→missing LrpB→ThemeOf→shift missing→ThemeOf→LrpB missing→CauseOf→shift
105	28615683	2494	L. gallinarum DSM 10532, L. crispatus DSM 20584 and P. cellicola DSM 17757 were all found to harbour a NisC homolog, despite not being identified by BAGEL.	NisC→ThemeOf→DSM 20584 DSM 20584→ThemeOf→NisC DSM 20584→CauseOf→harbour DSM→CauseOf→NisC DSM→CauseOf→harbour DSM→CauseOf→NisC DSM→CauseOf→harbour NisC→CauseOf→DSM NisC→CauseOf→DSM NisC→ThemeOf→harbour
106	28615683	2508	Whilst the operons in O. kitaharae DSM 17330 and L. intestinalis DSM 6629 appear to be complete, the L. crispatus DSM 20584 TOMM operon appears to lack a structural gene, however, the structural gene for similar operons has been found to be some distance from the SagBCD homologs previously.	SagBCD→ThemeOf→DSM 20584 SagBCD→ThemeOf→lack DSM 20584→ThemeOf→SagBCD DSM 20584→ThemeOf→lack
107	28615683	2509	Of these three strains, L. crispatus DSM 20584 was the only one found to display antimicrobial activity; the source of such activity, however, remains unclear.	DSM 20584→ThemeOf→antimicrobial activity antimicrobial activity→ThemeOf→DSM 20584
108	28615683	2518	While the source of antimicrobial activity from C. maltaromaticum DSM20342 is unclear, C. maltaromaticum DSM 20722 was found to produce the class IIa bacteriocin cbnB2 and cbnBM1, the class IId bacteriocin cbnX was also produced by the strain.	DSM 20722→ThemeOf→cbnBM1 DSM 20722→ThemeOf→cbnB2 cbnBM1→ThemeOf→produce cbnBM1→ThemeOf→DSM 20722 cbnB2→ThemeOf→produce cbnB2→ThemeOf→DSM 20722 DSM 20722→CauseOf→produce
109	28615683	2520	Such bacteriocins tend to contain conserved GxxxG or AxxxA motifs which are responsible for close helix interactions between each bacteriocin peptide.	AxxxA motifs→CauseOf→contain GxxxG→CauseOf→contain
110	28615683	2531	Leuconostoc mesenteroides TK41401 has also been shown to produce leucocyclicin Q, a subgroup I circular bacteriocin.	leucocyclicin→ThemeOf→Leuconostoc TK41401→ThemeOf→Leuconostoc Leuconostoc→ThemeOf→leucocyclicin Leuconostoc→ThemeOf→TK41401
111	28615683	2540	L. equicursoris DSM 19284 is also highly likely to produce a novel class IId bacteriocin (equicursorin).	DSM 19284→CauseOf→produce
112	28615683	2550	Two L. amylovorus strains (DSM 16698 and DSM 20531) were shown to produce a helveticin homolog.	DSM 16698→CauseOf→produce DSM 16698→ThemeOf→helveticin homolog helveticin homolog→ThemeOf→produce helveticin homolog→ThemeOf→DSM 16698 helveticin homolog→ThemeOf→DSM 20531 DSM 20531→CauseOf→produce DSM 20531→ThemeOf→helveticin homolog
113	28615683	2591	paracasei DSM 5622 was grown overnight in MRS broth.	DSM 5622→ThemeOf→paracasei paracasei→ThemeOf→DSM 5622
114	28651019	2626	Comparison of CRISPR arrays of L. pentosus MP-10 and phylogenetically related lactobacilli, such as L. plantarum, L. paraplantarum and L. brevis (available in CRISPRs database), showed that one DR consensus (5 -GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC-3 ) or its reverse complement was shared by all L. pentosus and L. plantarum strains except L. pentosus IG1 (Table 1).	5 -GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC-3→CauseOf→shared
115	28651019	2631	For example in CR1, we suggested that the primary invasion was accomplished by Haematospirillum jordaniae H5569 Plasmid unnamed 2, then by other short sequences followed by Borrelia miyamotoi FR64b Plasmid_07, and Clostridium taeniosporum 1/k Plasmid pCt3 (Table 2).	Haematospirillum jordaniae H5569→ThemeOf→primary Haematospirillum jordaniae H5569→ThemeOf→FR64b primary→ThemeOf→Haematospirillum jordaniae H5569 primary→ThemeOf→FR64b FR64b→ThemeOf→Haematospirillum jordaniae H5569 FR64b→ThemeOf→primary
116	28651019	2639	Among the eight genes of CRISPR2, five of them were shared by both L. pentosus strains (MP-10 and KCA1): cas1, cas2, cas3, casC, cas5 and cse3 (Fig 3B); however, both unique genes for L. pentosus MP-10 (XX999_01589 gene ID, or cse1_Lpe gene, and XX999_01590 gene ID, or cse2_Lpe gene) corresponded to CRISPR-associated protein (KCA1_RS06550) and cse2/casB (KCA1_RS06555) in L. pentosus KCA1.	KCA1_RS06550→ThemeOf→cse2/casB cse2/casB→ThemeOf→KCA1_RS06555 cse2/casB→ThemeOf→KCA1_RS06550 KCA1_RS06555→ThemeOf→cse2/casB
117	29942291	2696	Based on the presence/absence patterns of these genomic traits, strain ACA-DC 1533 seems to be more related to strain JCM 10692T than strain KCTC 13900.	ACA-DC 1533→CauseOf→related
118	29942291	2699	Nonetheless, strain KCTC 13900 has a prophage that is absent from strains ACA-DC 1533 and JCM 10692T.	KCTC 13900→CauseOf→absent
119	29942291	2709	Moreover, L. acidipiscis has also been found in vinegar and soy sauce, where it is considered to be a spoiler.	L. acidipiscis→CauseOf→found
120	29942291	2724	Weissella kandleri DSM 20593T and Lactobacillus delbrueckii subsp.	DSM 20593T→ThemeOf→Weissella DSM 20593T→ThemeOf→Lactobacillus Weissella→ThemeOf→DSM 20593T Lactobacillus→ThemeOf→DSM 20593T
121	29942291	2760	Core-genome analysis revealed that the motility operon is also present in strain JCM 10692T and flanked by the same genes (Supplementary Table S4B).	JCM→ThemeOf→motility motility→ThemeOf→JCM
122	29942291	2764	It is interesting to note that GI 5 is present in strains ACA-DC 1533 and JCM 10692T but absent in KCTC 13900.	ACA-DC→CauseOf→absent ACA-DC→ThemeOf→GI 5 GI 5→ThemeOf→absent GI 5→ThemeOf→ACA-DC
123	29942291	2769	Furthermore, strain KCTC 13900 seems to have an intact prophage region (from now on called phage 3) of 40.8 Kbp length related also to Lactobacillus phages (Supplementary Table S6A).	KCTC 13900→ThemeOf→Kbp Kbp→ThemeOf→KCTC 13900
124	29942291	2771	BLASTN analysis of all the spacers identified in these three CRISPR-Cas systems showed that several of them, namely spacers 9, 11, 13, 14, 19, 20, and 21 in CRISPR 1 and spacers 5, 14 and 21 in CRISPR 2 had hits in the Lactobacillus plantarum virulent phage phiJL-1.	spacers→CauseOf→Lactobacillus plantarum spacers→CauseOf→hits spacers→CauseOf→Lactobacillus plantarum Lactobacillus plantarum→ThemeOf→hits Lactobacillus plantarum→CauseOf→spacers Lactobacillus plantarum→CauseOf→spacers spacers→CauseOf→hits
125	29942291	2772	Moreover, spacers 22 and 26 in CRISPR 2 had hits in L. salivarius plasmids.	spacers→CauseOf→hits
126	29942291	2774	Thus, it could be hypothesized that strain KCTC 13900 has also been exposed to phage 1 or phage 2 but it was able to acquire immunity through its CRISPR-Cas systems.	CRISPR-Cas→ThemeOf→acquire immunity→ThemeOf→acquire KCTC 13900→CauseOf→acquire
127	29942291	2803	Indeed, the carbohydrate fermentation profile of L. acidipiscis ACA-DC 1533 using the API 50 CHL stripes (Supplementary Table S12) and L. salivarius UCC118 showed that the two strains were able to ferment a number of carbohydrates of plant origin, i.e., L-arabinose, D-ribose, D-cellobiose, D-trehalose, D-glucose, D-fructose, D-mannitol, D-sorbitol, and D-saccharose.	D-fructose→ThemeOf→D-sorbitol D-trehalose→ThemeOf→ferment L-arabinose→ThemeOf→D-fructose D-glucose→ThemeOf→L-arabinose D-saccharose→ThemeOf→CHL CHL→ThemeOf→D-fructose D-fructose→ThemeOf→L-arabinose D-trehalose→ThemeOf→D-saccharose L-arabinose→ThemeOf→D-trehalose D-glucose→ThemeOf→ferment D-saccharose→ThemeOf→D-fructose CHL→ThemeOf→D-trehalose D-fructose→ThemeOf→D-glucose D-sorbitol→ThemeOf→CHL L-arabinose→ThemeOf→D-sorbitol D-glucose→ThemeOf→D-saccharose D-saccharose→ThemeOf→D-trehalose CHL→ThemeOf→D-sorbitol D-fructose→ThemeOf→ferment D-sorbitol→ThemeOf→D-fructose L-arabinose→ThemeOf→D-glucose ferment→ThemeOf→CHL D-saccharose→ThemeOf→D-sorbitol CHL→ThemeOf→L-arabinose D-fructose→ThemeOf→D-saccharose D-sorbitol→ThemeOf→D-trehalose L-arabinose→ThemeOf→ferment ferment→ThemeOf→D-fructose D-saccharose→ThemeOf→L-arabinose CHL→ThemeOf→D-glucose D-trehalose→ThemeOf→CHL D-sorbitol→ThemeOf→L-arabinose L-arabinose→ThemeOf→D-saccharose ferment→ThemeOf→D-trehalose D-saccharose→ThemeOf→D-glucose CHL→ThemeOf→ferment D-trehalose→ThemeOf→D-fructose D-sorbitol→ThemeOf→D-glucose D-glucose→ThemeOf→CHL ferment→ThemeOf→D-sorbitol D-saccharose→ThemeOf→ferment CHL→ThemeOf→D-saccharose D-trehalose→ThemeOf→D-sorbitol D-sorbitol→ThemeOf→ferment D-glucose→ThemeOf→D-fructose ferment→ThemeOf→L-arabinose D-fructose→ThemeOf→CHL D-trehalose→ThemeOf→L-arabinose D-sorbitol→ThemeOf→D-saccharose D-glucose→ThemeOf→D-trehalose ferment→ThemeOf→D-glucose D-fructose→ThemeOf→D-trehalose D-trehalose→ThemeOf→D-glucose L-arabinose→ThemeOf→CHL D-glucose→ThemeOf→D-sorbitol ferment→ThemeOf→D-saccharose
128	29942291	2807	Similarly to what has been reported previously for L. salivarius UCC118 and according to our analysis, part of the glycobiome of both L. salivarius and L. acidipiscis ACA-DC 1533 resides in their plasmids.	UCC118→ThemeOf→ACA-DC 1533 ACA-DC 1533→ThemeOf→glycobiome ACA-DC 1533→ThemeOf→UCC118 glycobiome→ThemeOf→UCC118 glycobiome→ThemeOf→ACA-DC 1533 UCC118→ThemeOf→glycobiome
129	29942291	2815	Interestingly, the Opp operon is present in L. acidipiscis ACA-DC 1533 and JCM 10692T but absent in KCTC 13900.	ACA-DC→CauseOf→absent ACA-DC→ThemeOf→Opp operon Opp operon→ThemeOf→ACA-DC Opp operon→ThemeOf→absent Opp operon→ThemeOf→JCM JCM→CauseOf→absent JCM→ThemeOf→Opp operon
130	29942291	2817	However, it is worth noting that the DppD protein of L. acidipiscis KCTC 13900 is a potential pseudogene inactivating the entire Dpp system which deserves further investigation.	KCTC→ThemeOf→Dpp system KCTC→CauseOf→inactivating Dpp system→ThemeOf→KCTC Dpp system→ThemeOf→inactivating
131	29942291	2822	The higher number of IS elements in the chromosome of L. acidipiscis ACA-DC 1533 may suggest a higher potential for genome plasticity compared to the L. salivarius UCC118 and L. ruminis ATCC 27782 chromosome.	higher→CauseOf→higher higher→CauseOf→higher ACA-DC 1533→CauseOf→higher ACA-DC 1533→CauseOf→higher
132	29942291	2828	On the other hand, TFs contain TRs, OCSs, RRs and SFs.	RRs→ThemeOf→TRs RRs→ThemeOf→OCSs TRs→ThemeOf→RRs OCSs→ThemeOf→RRs
133	29942291	2848	Furthermore, acetoin, which was produced by L. acidipiscis ACA-DC 1533, can be formed from pyruvate using two alternative pathways.	ACA-DC 1533→ThemeOf→acetoin acetoin→ThemeOf→ACA-DC 1533
134	29942291	2849	Pyruvate, which derives from glycolysis, is converted into a-acetolactate by alpha-acetolactate synthase (LAC1533_RS03500).	LAC1533_RS03500→ThemeOf→a-acetolactate a-acetolactate→ThemeOf→LAC1533_RS03500
135	29942291	2851	Finally, diacetyl/acetoin dehydrogenase (LAC1533_RS01560) catalyzes the conversion of diacetyl to acetoin.	LAC1533_RS01560→ThemeOf→conversion of diacetyl to acetoin conversion of diacetyl to acetoin→ThemeOf→LAC1533_RS01560
136	29942291	2854	Given that L. acidipiscis ACA-DC 1533, along with L. rennini, were the only species found in Kopanisti cheese, the production of the above mentioned metabolites by L. acidipiscis ACA-DC 1533 via amino acid catabolism may contribute to the characteristic piquant flavor of Kopanisti cheese.	piquant flavor→CauseOf→L. acidipiscis ACA-DC 1533 L. acidipiscis ACA-DC 1533→CauseOf→contribute L. acidipiscis ACA-DC 1533→CauseOf→piquant flavor
137	30013519	2979	Interestingly, L. paracasei NFBC338 failed to produce futcin which was produced by E. coli.	NFBC338→CauseOf→failed
138	30013519	2982	Interestingly, pediocin 20336a and hordeiocin inhibited the growth of a larger number of the indicators tested than pediocin PA-1.	growth→CauseOf→pediocin hordeiocin→CauseOf→inhibited pediocin→CauseOf→inhibited pediocin→CauseOf→growth
139	30013519	3024	Futcin has a tryptophan residue at position 33 in the mature peptide; however this is not predicted to be involved in the stabilization of the hairpin fold; acidicin lacks a stabilizing terminal tryptophan residue altogether.	acidicin→CauseOf→lacks
140	30013519	3026	Structural differences between these bacteriocins may not only affect their inhibitory activity but also may affect the ability of the pediocin transporter to secrete these bacteriocins.	Structural→CauseOf→affect affect→CauseOf→affect affect→CauseOf→affect Structural→CauseOf→affect
141	30013519	3031	Pediocin, pediocin 20336a, rennicin A and rennicin B display between 84% and 93% homology to each other.	pediocin→ThemeOf→rennicin A pediocin→ThemeOf→rennicin B rennicin A→ThemeOf→pediocin rennicin B→ThemeOf→pediocin
142	30013519	3033	Two amino acid substitutions in rennicin B may explain this as they occur in important structural regions for the bacteriocin.	substitutions→ThemeOf→rennicin B substitutions→ThemeOf→bacteriocin rennicin B→ThemeOf→substitutions bacteriocin→ThemeOf→substitutions
143	30013519	3034	The Gly29-Ser29 substitution is found in the C-terminal alpha-helix of the peptide which is involved in membrane insertion.	membrane insertion→ThemeOf→Gly29-Ser29 membrane insertion→ThemeOf→involved found→CauseOf→involved Gly29-Ser29→ThemeOf→membrane insertion Gly29-Ser29→CauseOf→found Gly29-Ser29→CauseOf→involved involved→CauseOf→found membrane insertion→ThemeOf→found
144	30013519	3035	A Gly36-Ser36 substitution occurs in a double glycine motif which follows the alpha-helix.	Gly36-Ser36→CauseOf→occurs
145	30013519	3036	This motif may provide the flexibility for the C-terminal tail to fold back upon the helix (Fimland et al.,), this flexibility may be lost due to the substitution with a larger serine residue.	substitution→CauseOf→lost
146	30013519	3046	While duplications and false positives are likely to occur in these datasets, even if a small proportion of these genes can be analyzed using this expression system it represents a significant extension of the class II bacteriocins.	duplications→ThemeOf→bacteriocin bacteriocin→ThemeOf→duplications
147	30628884	10188	The predominant fatty acids were C16 : 0, C18 : 1 omega9c and summed feature 8.	C16→ThemeOf→summed feature C18→ThemeOf→summed feature summed feature→ThemeOf→C16 summed feature→ThemeOf→C18
148	30984126	3126	Furthermore, we analyzed the 16S rDNA gene polymorphisms (SNPs) of the same dominant species (Lactobacillus plantarum and Lactobacillus fermentum) in two fermented environments, which showed that most of the mutations occurred in fermented vegetables and that fermenting environment might be the major factor for these mutations.	mutations→ThemeOf→16S rDNA 16S rDNA→ThemeOf→mutations
149	30984126	3146	We identified the dominant bacterial genera in samples (Figure 3), which included Lactobacillus, Pediococcus, Weissella, Bacillus, Lactococcus, Pseudomonas, Acinetobacter, Rummeliibacillus, Enterobacter, Enterococcus and Sphingomonas.	Weissella→ThemeOf→Sphingomonas Pediococcus→ThemeOf→Sphingomonas Pseudomonas→ThemeOf→Pediococcus Weissella→ThemeOf→Pediococcus Pediococcus→ThemeOf→Weissella Lactobacillus→ThemeOf→Weissella Lactococcus→ThemeOf→Weissella Weissella→ThemeOf→Lactobacillus Pediococcus→ThemeOf→Lactobacillus Lactobacillus→ThemeOf→Pediococcus Lactococcus→ThemeOf→Pediococcus Weissella→ThemeOf→Enterobacter Pediococcus→ThemeOf→Enterobacter Enterobacter→ThemeOf→Weissella Rummeliibacillus→ThemeOf→Weissella Weissella→ThemeOf→Bacillus Pediococcus→ThemeOf→Bacillus Enterobacter→ThemeOf→Pediococcus Rummeliibacillus→ThemeOf→Pediococcus Weissella→ThemeOf→Acinetobacter Pediococcus→ThemeOf→Acinetobacter Bacillus→ThemeOf→Weissella Enterococcus→ThemeOf→Weissella Weissella→ThemeOf→Pseudomonas Pediococcus→ThemeOf→Pseudomonas Bacillus→ThemeOf→Pediococcus Enterococcus→ThemeOf→Pediococcus Weissella→ThemeOf→Lactococcus Pediococcus→ThemeOf→Lactococcus Acinetobacter→ThemeOf→Weissella Sphingomonas→ThemeOf→Weissella Weissella→ThemeOf→Rummeliibacillus Pediococcus→ThemeOf→Rummeliibacillus Acinetobacter→ThemeOf→Pediococcus Sphingomonas→ThemeOf→Pediococcus Weissella→ThemeOf→Enterococcus Pediococcus→ThemeOf→Enterococcus Pseudomonas→ThemeOf→Weissella
150	30984126	3169	We analyzed the SNPs of Lactobacillus plantarum and Lactobacillus fermentum and found that most of the mutations occurred in fermented vegetables.	mutations→CauseOf→occurred
151	31481601	3310	Within a species, an innovative mutation is able to purge diversity through a vertical sweep, but this process cannot occur between different species.	purge diversity→ThemeOf→mutation purge diversity→ThemeOf→nov mutation→ThemeOf→purge diversity mutation→ThemeOf→nov nov→ThemeOf→purge diversity nov→ThemeOf→mutation
152	31481601	3326	However, the publication that introduced the species L. amylotrophicus clearly shows that strain DSM 20534 is relatively distant from strain DSM 20533 based on a comparison of pheS and rpoA gene sequences.	DSM 20534→CauseOf→distant
153	31528033	3190	LAB are also called lantibiotics because they contain modified post-translational amino acids, such as lanthionine (two alanines linked by sulfur), beta-methyl-lanthionine, dehydroalanine, and dehydrobutyrine, which are short peptides (19-13 amino acids) and are active in Gram-positive bacteria.	Gram-positive bacteria→CauseOf→lanthionine lanthionine→CauseOf→Gram-positive bacteria lanthionine→CauseOf→active dehydrobutyrine→CauseOf→active dehydroalanine→CauseOf→active
154	31936280	3698	The majority of animal-derived strains could poorly utilize lactose, sucrose, raffinose, and FOS, except for FYNLJ31L4.	raffinose→ThemeOf→FYNLJ31L4 raffinose→ThemeOf→FOS FYNLJ31L4→ThemeOf→raffinose FYNLJ31L4→ThemeOf→FOS FOS→ThemeOf→raffinose FOS→ThemeOf→FYNLJ31L4
155	31936280	3699	Among the 81 strains, only FYNLJ31L4 exhibited the ability to utilize D-ribose, D-xylose and sodium gluconate, while it cannot take advantage of other sugars such as cellobiose, D fructose, and D mannose that are utilized by remaining 80 L. ruminis strains.	FYNLJ31L4→ThemeOf→D-ribose FYNLJ31L4→ThemeOf→sodium gluconate sodium gluconate→ThemeOf→D-ribose sodium gluconate→ThemeOf→FYNLJ31L4 D-ribose→ThemeOf→FYNLJ31L4 D-ribose→ThemeOf→sodium gluconate
156	31936280	3713	Insertion of the transposase in the raffinose operon of L. ruminis may affect its normal transcription leading to the inability to utilize raffinose (Figure 5D).	Insertion→CauseOf→affect
157	31936280	3726	Only L. ruminis DPC6832 contained a subtype I-B CRISPR/Cas system.	DPC6832→CauseOf→contained
158	31936280	3763	Accordingly, L. ruminis strains from human represented a broad variability in GH enzymes which would be corresponding to dietary diversity of human hosts.	GH enzymes→ThemeOf→variability variability→ThemeOf→GH enzymes
159	31936280	3766	Heretofore, the well-known bacteriocin produced by L. ruminis belonged to class IIa bacteriocin, in which L. ruminis ATCC 27782 generated a Class II pediocin-like bacteriocin.	bacteriocin→ThemeOf→generated bacteriocin→ThemeOf→ATCC bacteriocin→ThemeOf→generated bacteriocin→ThemeOf→ATCC bacteriocin→ThemeOf→generated ATCC→ThemeOf→bacteriocin ATCC→ThemeOf→bacteriocin ATCC→ThemeOf→bacteriocin ATCC→CauseOf→generated bacteriocin→ThemeOf→ATCC
160	32010538	3405	B. subtilis bs-30 and bs-34 also possessed high IL-22-inducing ability.	bs-34→ThemeOf→IL-22-inducing bs-34→CauseOf→high bs-30→ThemeOf→IL-22-inducing bs-30→CauseOf→high IL-22-inducing→ThemeOf→bs-34 IL-22-inducing→ThemeOf→bs-30 IL-22-inducing→ThemeOf→high
161	32010538	3425	Because administration of IL-22 decreased TEWL and neutralization of IL-22 increased TEWL, the improvement of skin barrier function caused by B. coagulans sc-09 uptake may be attributed to IL-22.	TEWL→ThemeOf→skin barrier function neutralization→CauseOf→increased increased→CauseOf→decreased TEWL→ThemeOf→neutralization neutralization→CauseOf→improvement increased→CauseOf→improvement TEWL→ThemeOf→decreased decreased→CauseOf→increased improvement→CauseOf→decreased TEWL→ThemeOf→TEWL decreased→CauseOf→improvement improvement→CauseOf→increased skin barrier function→ThemeOf→TEWL TEWL→ThemeOf→increased TEWL→ThemeOf→skin barrier function skin barrier function→ThemeOf→neutralization TEWL→ThemeOf→improvement TEWL→ThemeOf→TEWL skin barrier function→ThemeOf→decreased neutralization→ThemeOf→skin barrier function TEWL→ThemeOf→neutralization skin barrier function→ThemeOf→TEWL neutralization→ThemeOf→TEWL TEWL→ThemeOf→decreased skin barrier function→ThemeOf→increased neutralization→CauseOf→decreased TEWL→ThemeOf→increased skin barrier function→ThemeOf→improvement neutralization→ThemeOf→TEWL TEWL→ThemeOf→improvement
162	32118050	3600	At the species level, L. acidipiscis was predominant bacteria for non-myopathy birds (68.16%) (Figure 3).	L. acidipiscis→ThemeOf→myopathy birds myopathy birds→ThemeOf→L. acidipiscis
163	32118050	3626	Elevated homocysteine is associated as marker for cardiovascular disease and can be atherogenic and thrombogenic.	homocysteine→ThemeOf→cardiovascular disease homocysteine→ThemeOf→Elevated cardiovascular disease→ThemeOf→Elevated cardiovascular disease→ThemeOf→homocysteine Elevated→ThemeOf→cardiovascular disease Elevated→ThemeOf→homocysteine
164	32184766	3787	The monosaccharide compositional analysis indicated that crude EPS-CS5, EPS-CS9, EPS-CS18, and EPS-CS20 contain similar monosaccharide compositions with different ratios.	EPS-CS20→ThemeOf→EPS-CS5 EPS-CS5→ThemeOf→EPS-CS20 EPS-CS5→ThemeOf→EPS-CS9 EPS-CS5→ThemeOf→EPS-CS18 EPS-CS9→ThemeOf→EPS-CS5 EPS-CS18→ThemeOf→EPS-CS5
165	32184766	3873	For instance, a heavy metal transporter CzcA (DR994_03030) predicted in CS9 genome is responsible for the transport of heavy metal ions, and it shows 100% similarity to a gene of Streptococcus pneumoniae.	heavy→ThemeOf→transport of heavy metal ions heavy→ThemeOf→DR994_03030 heavy→ThemeOf→CzcA DR994_03030→ThemeOf→transport of heavy metal ions DR994_03030→ThemeOf→heavy DR994_03030→ThemeOf→CzcA CzcA→ThemeOf→transport of heavy metal ions transport of heavy metal ions→ThemeOf→heavy CzcA→ThemeOf→heavy transport of heavy metal ions→ThemeOf→DR994_03030 CzcA→ThemeOf→DR994_03030 transport of heavy metal ions→ThemeOf→CzcA
166	32184766	3881	Therefore, it could be suggested that CS5, CS9, CS18, and CS20 do not contain any antibiotic resistance and that they do not cause antibiotic contamination when used as a food starter.	CS9→CauseOf→cause CS20→CauseOf→cause CS18→CauseOf→cause CS5→CauseOf→cause
167	32184766	3883	As can be seen from the results, S. thermophilus CS5, CS9, CS18, and CS20 are all sensitive to these 12 common antibiotics, which is consistent with the results of the genomic analysis.	CS18→CauseOf→sensitive CS20→ThemeOf→CS9 CS20→CauseOf→sensitive CS5→ThemeOf→CS9 CS5→CauseOf→sensitive CS9→ThemeOf→CS5 CS9→ThemeOf→CS18 CS9→ThemeOf→sensitive CS9→ThemeOf→CS20 CS18→ThemeOf→CS9
168	32184766	3900	In summary, S. thermophilus CS5, CS9, CS18, and CS20 do not contain antibiotic resistance genes, virulence factors with significant pathogenicity, or plasmids that can replicate independently.	CS20→ThemeOf→CS5 CS5→ThemeOf→CS20 CS5→ThemeOf→CS9 CS5→ThemeOf→CS18 CS9→ThemeOf→CS5 CS18→ThemeOf→CS5
169	32184766	3923	As CS18 and CS20 could utilize galactose, they could be used in the production of cheese in order to eliminate or reduce the adverse influences of galactose accumulation.	galactose→ThemeOf→CS20 CS20→CauseOf→reduce CS20→ThemeOf→galactose galactose→ThemeOf→reduce
170	32184766	3942	The eps gene clusters determining the EPS biosynthesis were found in CS5, CS9, CS18, and CS20 (Figure 7A).	CS5→ThemeOf→eps CS20→ThemeOf→eps CS9→ThemeOf→eps eps→ThemeOf→CS5 eps→ThemeOf→CS20 eps→ThemeOf→CS9
171	32184766	3946	In addition, these eps clusters belonged to a common type and were found in some S. thermophilus strains, including ASCC1275, Sfi39, KLDS MS, MN-BM-A02, DGCC7710, C106, KLDS 3.1003, TH982, FI9186, and MTC310.	ASCC1275→ThemeOf→DGCC7710 Sfi39→ThemeOf→MN-BM-A02 Sfi39→ThemeOf→DGCC7710 MN-BM-A02→ThemeOf→ASCC1275 MN-BM-A02→ThemeOf→Sfi39 DGCC7710→ThemeOf→ASCC1275 DGCC7710→ThemeOf→Sfi39 ASCC1275→ThemeOf→MN-BM-A02
172	32184766	3953	Therefore, it was speculated that the additional eps2A-eps2B could improve the EPS production.	eps2A-eps2B→ThemeOf→EPS production EPS production→ThemeOf→improve EPS production→ThemeOf→eps2A-eps2B eps2A-eps2B→CauseOf→improve
173	32184766	3956	These GTFs (DR994_01925, DR994_01930, DR994_01935, and DR994_01955) originated from Clostridium butyricum, Eubacteriaceae bacterium, Streptococcus equinus, and Lactococcus lactis, respectively.	DR994_01935→ThemeOf→GTFs DR994_01930→ThemeOf→GTFs GTFs→ThemeOf→DR994_01935 GTFs→ThemeOf→DR994_01930 GTFs→ThemeOf→DR994_01925 GTFs→ThemeOf→DR994_01955 DR994_01925→ThemeOf→GTFs DR994_01955→ThemeOf→GTFs
174	32184766	3957	DR994_01925 was predicted to belong to GTF family 2 which could transfer sugar from UDP-glucose, UDP-N-acetyl-galactosamine (UDP-GalNAc), or GDP-mannose to a range of substrates.	UDP-glucose→ThemeOf→UDP-N-acetyl-galactosamine UDP-N-acetyl-galactosamine→ThemeOf→GTF family 2 DR994_01925→ThemeOf→GTF family 2 UDP-glucose→ThemeOf→transfer UDP-N-acetyl-galactosamine→ThemeOf→transfer DR994_01925→ThemeOf→UDP-N-acetyl-galactosamine UDP-glucose→ThemeOf→sugar UDP-N-acetyl-galactosamine→ThemeOf→sugar DR994_01925→CauseOf→transfer UDP-glucose→ThemeOf→DR994_01925 UDP-N-acetyl-galactosamine→ThemeOf→DR994_01925 DR994_01925→ThemeOf→sugar GTF family 2→ThemeOf→UDP-glucose sugar→ThemeOf→UDP-glucose GTF family 2→ThemeOf→UDP-N-acetyl-galactosamine sugar→ThemeOf→GTF family 2 GTF family 2→ThemeOf→transfer sugar→ThemeOf→UDP-N-acetyl-galactosamine GTF family 2→ThemeOf→sugar sugar→ThemeOf→transfer GTF family 2→ThemeOf→DR994_01925 sugar→ThemeOf→DR994_01925 UDP-glucose→ThemeOf→GTF family 2 UDP-N-acetyl-galactosamine→ThemeOf→UDP-glucose DR994_01925→ThemeOf→UDP-glucose
175	32184766	3958	It was speculated that EPS-CS9 might contain rhamnose.	rhamnose→ThemeOf→EPS-CS9 rhamnose→ThemeOf→contain EPS-CS9→ThemeOf→rhamnose EPS-CS9→CauseOf→contain
176	32184766	3959	DR994_01955, however, was found similar to galactosyl transferase CpsE which could catalyze the addition of galactose to an oligosaccharide precursor or to a lipid intermediate.	CpsE→ThemeOf→DR994_01955 CpsE→ThemeOf→addition addition→ThemeOf→DR994_01955 addition→ThemeOf→CpsE DR994_01955→ThemeOf→CpsE DR994_01955→ThemeOf→addition
177	32184766	3960	At the same time, a relatively rare galactofuranose transferase (DR994_01870) was found in CS9, which was detected only in S. thermophilus strains 488, DSM 20617, JIM8232, and TH1436.	DR994_01870→CauseOf→found
178	32184766	3980	The monosaccharide compositions of crude EPS-CS5, EPS-CS9, EPS-CS18, and EPS-CS20 were analyzed using HPLC.	monosaccharide compositions→ThemeOf→EPS-CS20 EPS-CS9→ThemeOf→monosaccharide compositions EPS-CS9→ThemeOf→EPS-CS5 EPS-CS5→ThemeOf→EPS-CS18 EPS-CS5→ThemeOf→monosaccharide compositions EPS-CS18→ThemeOf→monosaccharide compositions EPS-CS5→ThemeOf→EPS-CS9 EPS-CS18→ThemeOf→EPS-CS5 EPS-CS5→ThemeOf→EPS-CS20 monosaccharide compositions→ThemeOf→EPS-CS18 EPS-CS20→ThemeOf→monosaccharide compositions monosaccharide compositions→ThemeOf→EPS-CS9 EPS-CS20→ThemeOf→EPS-CS5 monosaccharide compositions→ThemeOf→EPS-CS5
179	32184766	3999	In terms of bile salt tolerance, CS18 was also the most resistant to bile salt, with a survival rate of 94.40%, while CS5 had the weakest bile salt resistance, with a survival rate as low as 53.17% after incubation with 0.3% bile salt.	CS18→CauseOf→resistant
180	32184766	4004	Among all the strains investigated in this study apart from CS5, CS9, CS18, and CS20 strains, only seven strains (Supplementary Table S1) were found to contain gadB gene, including B59671, APC151, GABA, KLDS_3.1003, TH1435, ND03, and ACA-DC 2.	B59671→ThemeOf→gadB gadB→ThemeOf→B59671
181	32184766	4020	In addition, the results showed that the pHin value of CS9 cells with the supplement of 1% MSG was significantly higher than in M17 liquid medium (pH 2.5) (Figure 10D).	MSG→CauseOf→higher
182	32184766	4038	The datasets generated for this study can be found in the nucleotide sequences of CS5, CS9, CS18 and CS20 genomes were submitted to GenBank and assigned accession numbers CP028896, CP030927, CP030928, and CP030250.	CP030927→ThemeOf→CS5 CP028896→ThemeOf→CS5 CS5→ThemeOf→CP030927 CS5→ThemeOf→CP028896 CS5→ThemeOf→CP030928 CS5→ThemeOf→CP030250 CP030928→ThemeOf→CS5 CP030250→ThemeOf→CS5
183	32226414	4048	The microflora in raw camel milk consists of Streptococcus, Lactococcus, Weissella, Pediococcus, Lactobacillus, and Enterococcus.	Lactococcus→ThemeOf→Weissella Lactobacillus→ThemeOf→Weissella Weissella→ThemeOf→Streptococcus Enterococcus→ThemeOf→Weissella Weissella→ThemeOf→Lactococcus Weissella→ThemeOf→Enterococcus Weissella→ThemeOf→Lactobacillus Weissella→ThemeOf→Pediococcus Streptococcus→ThemeOf→Weissella Pediococcus→ThemeOf→Weissella
184	32226414	4138	Among them, phenylethyl alcohol and 5-decanolide were the most abundant compounds in StC with a high correlation coefficient (mainly up to 0.80).	StC→ThemeOf→phenylethyl phenylethyl→ThemeOf→StC
185	32226414	4165	The sequencing data can be found in NCBI under the following accession numbers: MN966848, MN966849, MN966850, and MN966851.	MN966849→ThemeOf→NCBI MN966848→ThemeOf→NCBI NCBI→ThemeOf→MN966849 NCBI→ThemeOf→MN966848 NCBI→ThemeOf→MN966851 NCBI→ThemeOf→MN966850 MN966851→ThemeOf→NCBI MN966850→ThemeOf→NCBI
186	32295530	4347	In particular, L. acidophilus, L. casei, L. rhamnosus, L. plantarum, and L. paracasei are often used in probiotic products in combination with other Lactobacillus species.	L. paracasei→CauseOf→used
187	32591517	4462	Recent advances in metagenomics have revealed that alterations in the human gut microbiota are implicated in a number of disorders, such as obesity, inflammatory bowel disease, colorectal cancer, and diabetes.	diabetes→ThemeOf→obesity obesity→ThemeOf→gut microbiota colorectal cancer→ThemeOf→disorders gut microbiota→ThemeOf→colorectal cancer alterations→CauseOf→implicated in diabetes→ThemeOf→colorectal cancer obesity→ThemeOf→alterations inflammatory bowel disease→ThemeOf→diabetes gut microbiota→ThemeOf→inflammatory bowel disease alterations→ThemeOf→disorders diabetes→ThemeOf→inflammatory bowel disease obesity→ThemeOf→implicated in inflammatory bowel disease→ThemeOf→obesity gut microbiota→ThemeOf→alterations disorders→ThemeOf→diabetes diabetes→ThemeOf→gut microbiota obesity→ThemeOf→disorders inflammatory bowel disease→ThemeOf→colorectal cancer gut microbiota→ThemeOf→implicated in disorders→ThemeOf→obesity diabetes→ThemeOf→alterations colorectal cancer→ThemeOf→diabetes inflammatory bowel disease→ThemeOf→gut microbiota gut microbiota→ThemeOf→disorders disorders→ThemeOf→colorectal cancer diabetes→ThemeOf→implicated in colorectal cancer→ThemeOf→obesity inflammatory bowel disease→ThemeOf→alterations alterations→ThemeOf→diabetes disorders→ThemeOf→inflammatory bowel disease diabetes→ThemeOf→disorders colorectal cancer→ThemeOf→inflammatory bowel disease inflammatory bowel disease→ThemeOf→implicated in alterations→ThemeOf→obesity disorders→ThemeOf→gut microbiota obesity→ThemeOf→diabetes colorectal cancer→ThemeOf→gut microbiota inflammatory bowel disease→ThemeOf→disorders alterations→ThemeOf→colorectal cancer disorders→ThemeOf→alterations obesity→ThemeOf→colorectal cancer colorectal cancer→ThemeOf→alterations gut microbiota→ThemeOf→diabetes alterations→ThemeOf→inflammatory bowel disease disorders→ThemeOf→implicated in obesity→ThemeOf→inflammatory bowel disease colorectal cancer→ThemeOf→implicated in gut microbiota→ThemeOf→obesity alterations→ThemeOf→gut microbiota
188	32709144	4580	Industrial microbiology has been making use of microorganisms, such as naturally occurring ones, laboratory-selected mutants, or genetically modified organisms, to produce a wide variety of industrial products of human interest.	mutants→CauseOf→produce
189	32709144	4583	In recent years, an increase in the frequency of application of autochthonous strains to the manufacture of table olives has been witnessed, despite the scarce scientific studies available thereon.	autochthonous→CauseOf→increase
190	32709144	4588	Unfermented olives and olives by one day of fermentation were composed solely of (Enterobacteriaceae) Hafnia alvei and Methylobacterium sp; conversely, L. plantarum and L. pentosus dominated the metabolically active microbiota of Ctrl brines and olives by the end of fermentation.	L. pentosus→CauseOf→dominated L. pentosus→ThemeOf→metabolically L. plantarum→CauseOf→dominated L. plantarum→ThemeOf→metabolically metabolically→ThemeOf→L. pentosus metabolically→ThemeOf→dominated metabolically→ThemeOf→L. plantarum
191	32709144	4633	Germane species found include Alkalibacterium pelagium, Alkalibacterium psychrotoleran, Halolactibacillus sp., and Marinilactibacillus psychrotolerans/piezotolerans.	Halolactibacillus→ThemeOf→Alkalibacterium psychrotoleran Alkalibacterium→ThemeOf→Alkalibacterium psychrotoleran Halolactibacillus→ThemeOf→psychrotolerans/piezotolerans Alkalibacterium→ThemeOf→psychrotolerans/piezotolerans Halolactibacillus→ThemeOf→Alkalibacterium Alkalibacterium psychrotoleran→ThemeOf→Halolactibacillus Alkalibacterium psychrotoleran→ThemeOf→psychrotolerans/piezotolerans Alkalibacterium psychrotoleran→ThemeOf→Alkalibacterium psychrotolerans/piezotolerans→ThemeOf→Halolactibacillus psychrotolerans/piezotolerans→ThemeOf→Alkalibacterium psychrotoleran psychrotolerans/piezotolerans→ThemeOf→Alkalibacterium Alkalibacterium→ThemeOf→Halolactibacillus
192	32781677	4703	Particularly, during industrial experiments, C. maltaromaticum CNB06 and Lcb.	Lcb→ThemeOf→CNB06 CNB06→ThemeOf→Lcb
193	32781677	4729	sakei LSK04 (SA), Lcb.	LSK04→ThemeOf→Lcb Lcb→ThemeOf→LSK04
194	32781677	4774	When bacterial strains were isolated and identified, Obesumbacterium proteus was the most frequent, accounting for more than 40% of isolates in both seasons; this microorganism is usually recognized as a brewery contaminant but was also found in cheese.	Obesumbacterium→CauseOf→found
195	32781677	4784	In addition, in samples where a mix of Enterobacteriaceae and Pseudomonas was intentionally spiked by spraying on cheese surfaces, C. maltaromaticum CNB06 confirmed its inhibitory effect, lowering the spoiling bacteria between 2-3 Log CFU/g.	C. maltaromaticum CNB06→CauseOf→lowering CNB06→CauseOf→lowering
196	32824085	4896	Furthermore, Nostocaceae was the second most common family found in samples from Magnesia, Kavala and Halkidiki, whereas Leuconostocaceae was the second abundant family detected in samples from the Fthiotida region.	Nostocaceae→ThemeOf→Leuconostocaceae Leuconostocaceae→ThemeOf→Nostocaceae
197	33144553	9462	Lactobacillus delbrueckii comprises six subspecies, namely delbrueckii, lactis, bulgaricus, indicus, jakobsenii, and sunkii, all of which have historically been differentiated based on their ability to metabolize different carbohydrates.	delbrueckii→CauseOf→Lactobacillus Lactobacillus→CauseOf→delbrueckii
198	33144553	9463	lactis and bulgaricus are usually associated with the manufacture of dairy products such as cheeses and yogurt.	bulgaricus→CauseOf→associated
199	33233322	4994	Two sequence variants were identified in each of the four genomic segments harboring hlyC, cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB, respectively.	trxA-truB-rsuA→ThemeOf→rplS-tyrS-csdB trxA-truB-rsuA→ThemeOf→hlyC rplS-tyrS-csdB→ThemeOf→hlyC rplS-tyrS-csdB→ThemeOf→trxA-truB-rsuA hlyC→ThemeOf→rplS-tyrS-csdB hlyC→ThemeOf→trxA-truB-rsuA
200	33233322	4997	This RFLP-based typing method could be a useful tool for investigating the ecology of CaPsol and the epidemiology of its associated diseases.	RFLP-based→ThemeOf→CaPsol CaPsol→ThemeOf→RFLP-based
201	33233322	5021	In fact, in Europe, CaPsol tuf-type a and tuf-type b are mainly associated with nettle and bindweed, respectively.	tuf-type b→ThemeOf→nettle tuf-type b→CauseOf→associated tuf-type b→ThemeOf→bindweed CaPsol tuf-type a→ThemeOf→nettle bindweed→ThemeOf→CaPsol tuf-type a CaPsol tuf-type a→CauseOf→associated CaPsol tuf-type a→ThemeOf→bindweed bindweed→ThemeOf→tuf-type b nettle→ThemeOf→CaPsol tuf-type a bindweed→ThemeOf→associated nettle→ThemeOf→tuf-type b nettle→ThemeOf→associated
202	33233322	5026	Previous studies on plants and humans indicated that a single substitution between Val and Ile or between Asp and Asn could modify receptor binding activity or enzymatic catalytic activity.	enzymatic catalytic activity→ThemeOf→modify substitution→ThemeOf→enzymatic catalytic activity substitution→ThemeOf→receptor binding activity substitution→CauseOf→modify receptor binding activity→ThemeOf→enzymatic catalytic activity receptor binding activity→ThemeOf→substitution receptor binding activity→ThemeOf→modify enzymatic catalytic activity→ThemeOf→substitution enzymatic catalytic activity→ThemeOf→receptor binding activity
203	33233322	5027	Thus, key amino acid substitutions in CaPsol tufB genes could also change EF-Tu activity and/or modify interactions with its binding protein(s).	modify→CauseOf→change change→CauseOf→modify substitutions→CauseOf→modify substitutions→CauseOf→change
204	33233322	5041	In silico digestion, carried out on the representative nucleotide sequences of CaPsol sequence variants of the hlyC, cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB genomic fragments, allowed generation of virtual RFLP profiles for the restriction enzymes SspI, Hpy188I, BsaHI, and HpyCH4V, respectively (Figure 4).	Hpy188I→ThemeOf→SspI SspI→ThemeOf→RFLP profiles SspI→ThemeOf→Hpy188I SspI→ThemeOf→variants RFLP profiles→ThemeOf→SspI variants→ThemeOf→SspI
205	33233322	5045	In particular, the major contribution to the variability among these lineages is due to SNPs within the cbiQ-glyA, trxA-truB-rsuA, and rplS-tyrS-csdB genomic fragments.	rplS-tyrS-csdB→ThemeOf→SNPs cbiQ-glyA→ThemeOf→rplS-tyrS-csdB rplS-tyrS-csdB→ThemeOf→cbiQ-glyA cbiQ-glyA→ThemeOf→variability rplS-tyrS-csdB→ThemeOf→trxA-truB-rsuA cbiQ-glyA→ThemeOf→SNPs variability→ThemeOf→rplS-tyrS-csdB cbiQ-glyA→ThemeOf→trxA-truB-rsuA variability→ThemeOf→SNPs trxA-truB-rsuA→ThemeOf→rplS-tyrS-csdB variability→ThemeOf→cbiQ-glyA trxA-truB-rsuA→ThemeOf→variability variability→ThemeOf→trxA-truB-rsuA trxA-truB-rsuA→ThemeOf→cbiQ-glyA SNPs→ThemeOf→rplS-tyrS-csdB SNPs→ThemeOf→variability rplS-tyrS-csdB→ThemeOf→variability SNPs→ThemeOf→cbiQ-glyA
206	33233322	5051	It is reasonable to hypothesize that this variability in CaPsol strains could be related to the ecological complexity of vineyards and their surroundings, including the presence of multiple insect vectors and alternative plant hosts.	variability→ThemeOf→CaPsol CaPsol→ThemeOf→related CaPsol→ThemeOf→variability variability→CauseOf→related
207	33233322	5052	The RFLP-based typing method used in the present study could be considered to be a valuable tool for research on the ecology of CaPsol and the epidemiology of its associated diseases.	RFLP-based→ThemeOf→CaPsol CaPsol→ThemeOf→RFLP-based
208	33233322	5066	Actual RFLP analyses were performed using the enzyme SspI on hlyC amplicons, Hpy188I on cbiQ-glyA amplicons, BsaHI on trxA-truB-rsuA amplicons, and HpyCH4V on rplS-tyrS-csdB amplicons, respectively.	HpyCH4V→ThemeOf→cbiQ-glyA rplS-tyrS-csdB→ThemeOf→RFLP HpyCH4V→ThemeOf→RFLP HpyCH4V→ThemeOf→rplS-tyrS-csdB cbiQ-glyA→ThemeOf→Hpy188I RFLP→ThemeOf→cbiQ-glyA cbiQ-glyA→ThemeOf→HpyCH4V RFLP→ThemeOf→Hpy188I cbiQ-glyA→ThemeOf→RFLP RFLP→ThemeOf→HpyCH4V cbiQ-glyA→ThemeOf→rplS-tyrS-csdB RFLP→ThemeOf→rplS-tyrS-csdB Hpy188I→ThemeOf→cbiQ-glyA rplS-tyrS-csdB→ThemeOf→cbiQ-glyA Hpy188I→ThemeOf→RFLP rplS-tyrS-csdB→ThemeOf→Hpy188I Hpy188I→ThemeOf→rplS-tyrS-csdB rplS-tyrS-csdB→ThemeOf→HpyCH4V
209	33444386	5076	Additionally, other beneficial bacteria were detected including Staphylococcus nepalensis, Lactobacillus sakei, Lactobacillus pentosus, Weissella confusa, and Bifidobacterium bifidum.	Weissella→ThemeOf→Lactobacillus Weissella→ThemeOf→Staphylococcus Weissella→ThemeOf→Bifidobacterium Lactobacillus→ThemeOf→Weissella Staphylococcus→ThemeOf→Weissella Bifidobacterium→ThemeOf→Weissella
210	33444386	5182	Moreover, there is some evidence that Staphylococcus (S. nepalensis and S. xylosus) are able to improve odor by affecting volatile compounds in the fish sauce.	S. nepalensis→CauseOf→affecting odor→ThemeOf→volatile compounds S. nepalensis→CauseOf→improve odor→ThemeOf→affecting S. nepalensis→ThemeOf→odor odor→ThemeOf→improve volatile compounds→ThemeOf→S. nepalensis volatile compounds→ThemeOf→affecting volatile compounds→ThemeOf→improve volatile compounds→ThemeOf→odor affecting→CauseOf→improve improve→CauseOf→affecting S. nepalensis→ThemeOf→volatile compounds odor→ThemeOf→S. nepalensis
211	33444386	5189	Additionally, to our knowledge, many genera we found in this study have not been previously reported in pla-ra; these include Fusobacterium, Subdoligranulum, Ruminococcaceae_UCG-014, Erysipelotrichaceae_UCG-003 and Bifidobacterium (Fig 1 and S1 Table).	Erysipelotrichaceae→ThemeOf→Fusobacterium Erysipelotrichaceae→ThemeOf→Bifidobacterium Fusobacterium→ThemeOf→Erysipelotrichaceae Fusobacterium→ThemeOf→Bifidobacterium Bifidobacterium→ThemeOf→Erysipelotrichaceae Bifidobacterium→ThemeOf→Fusobacterium
212	33548354	6695	Microbial community changes in a female rat model of Rett syndrome Rett syndrome (RTT) is an X-linked neurodevelopmental disorder that is predominantly caused by alterations of the methyl-CpG-binding protein 2 (MECP2) gene.	MECP2→ThemeOf→alterations alterations→ThemeOf→MECP2 X-linked neurodevelopmental disorder→ThemeOf→caused by alterations→ThemeOf→X-linked neurodevelopmental disorder X-linked neurodevelopmental disorder→ThemeOf→MECP2 alterations→ThemeOf→Rett syndrome X-linked neurodevelopmental disorder→ThemeOf→Rett syndrome X-linked neurodevelopmental disorder→ThemeOf→alterations Rett syndrome→ThemeOf→caused by Rett syndrome→ThemeOf→MECP2 MECP2→ThemeOf→caused by Rett syndrome→ThemeOf→X-linked neurodevelopmental disorder MECP2→ThemeOf→X-linked neurodevelopmental disorder Rett syndrome→ThemeOf→alterations MECP2→ThemeOf→Rett syndrome alterations→CauseOf→caused by
213	33548354	6698	Although the gut microbiome has been previously characterized in humans with RTT compared to healthy controls, the impact of MECP2 mutation on the composition of the gut microbiome in animal models where the host and diet can be experimentally controlled remains to be elucidated.	composition of the gut microbiome→ThemeOf→mutation MECP2→ThemeOf→impact MECP2→ThemeOf→RTT RTT→ThemeOf→impact MECP2→ThemeOf→composition of the gut microbiome RTT→ThemeOf→composition of the gut microbiome MECP2→ThemeOf→mutation RTT→ThemeOf→MECP2 mutation→CauseOf→impact RTT→ThemeOf→mutation mutation→ThemeOf→RTT composition of the gut microbiome→ThemeOf→impact mutation→ThemeOf→composition of the gut microbiome composition of the gut microbiome→ThemeOf→RTT mutation→ThemeOf→MECP2 composition of the gut microbiome→ThemeOf→MECP2
214	33548354	6702	Greater than 95% of all cases of RTT harbor alterations in the methyl-CpG-binding protein 2 (MECP2) gene.	alterations→ThemeOf→RTT MECP2→ThemeOf→alterations MECP2→ThemeOf→RTT RTT→ThemeOf→alterations RTT→ThemeOf→MECP2 alterations→ThemeOf→MECP2
215	33548354	6723	Originally Wistar, WT S100b eGFP males were back crossed over 10 generations onto a Sprague Dawley background prior to crossing with Mecp2ZFN/+.	Mecp2ZFN/+→ThemeOf→eGFP Mecp2ZFN/+→ThemeOf→S100b eGFP→ThemeOf→Mecp2ZFN/+ S100b→ThemeOf→Mecp2ZFN/+
216	33548354	6752	However, Mecp2ZFN/+ rats begin to diverge from WT rats in beta diversity at p49, and continue to be significantly distinct through p196 (Fig.	Mecp2ZFN/+→ThemeOf→beta diversity beta diversity→ThemeOf→Mecp2ZFN/+
217	33548354	6756	At p35, the gut microbiota of both Mecp2ZFN/+ and WT rats is characterized by dominance of Bacteroidetes and Firmicutes phyla, as is also apparent in the aforementioned human studies.	Mecp2ZFN/+→CauseOf→dominance
218	33548354	6759	Additionally, A. muciniphila are lower in abundance in Mecp2ZFN/+ rats compared to WT (Fig.	Mecp2ZFN/+→CauseOf→lower
219	33548354	6785	Rat models of RTT have previously been utilized to assess the longitudinal effects of MECP2 mutations on neural, motor, and metabolic symptoms.	neural→ThemeOf→mutations MECP2→ThemeOf→neural MECP2→ThemeOf→RTT MECP2→ThemeOf→mutations RTT→ThemeOf→MECP2 RTT→ThemeOf→mutations mutations→ThemeOf→neural neural→ThemeOf→MECP2 mutations→ThemeOf→MECP2 mutations→ThemeOf→RTT
220	33548354	6799	In the current study, we found that Mecp2ZFN/+ differed from WT rats only in beta diversity measures.	Mecp2ZFN/+→ThemeOf→beta diversity measures beta diversity measures→ThemeOf→Mecp2ZFN/+
221	33548354	6806	In the current study, we observed broad taxonomy shifts in the microbiomes of Mecp2ZFN/+ rats compared to WT rats beginning at p49, persisting through p105, and re-emerging at p196.	microbiomes→ThemeOf→shifts Mecp2ZFN/+→ThemeOf→taxonomy Mecp2ZFN/+→CauseOf→shifts Mecp2ZFN/+→ThemeOf→microbiomes taxonomy→ThemeOf→Mecp2ZFN/+ taxonomy→ThemeOf→shifts taxonomy→ThemeOf→microbiomes microbiomes→ThemeOf→Mecp2ZFN/+ microbiomes→ThemeOf→taxonomy
222	33548354	6807	Specifically, at p105, we observed significant changes in the abundance of B. ovatus, B. uniformis, L. ruminis, and A. muciniphila in Mecp2ZFN/+ rats compared to WT.	A. muciniphila→ThemeOf→abundance abundance→ThemeOf→Mecp2ZFN/+ B. uniformis→ThemeOf→abundance L. ruminis→ThemeOf→changes Mecp2ZFN/+→CauseOf→changes abundance→ThemeOf→B. ovatus L. ruminis→ThemeOf→A. muciniphila Mecp2ZFN/+→ThemeOf→L. ruminis abundance→ThemeOf→B. uniformis L. ruminis→ThemeOf→Mecp2ZFN/+ Mecp2ZFN/+→ThemeOf→A. muciniphila B. ovatus→ThemeOf→changes L. ruminis→ThemeOf→abundance Mecp2ZFN/+→ThemeOf→abundance B. ovatus→ThemeOf→L. ruminis L. ruminis→ThemeOf→B. ovatus Mecp2ZFN/+→ThemeOf→B. ovatus B. ovatus→ThemeOf→Mecp2ZFN/+ L. ruminis→ThemeOf→B. uniformis Mecp2ZFN/+→ThemeOf→B. uniformis B. ovatus→ThemeOf→abundance A. muciniphila→ThemeOf→changes abundance→ThemeOf→changes B. uniformis→ThemeOf→changes A. muciniphila→ThemeOf→L. ruminis abundance→ThemeOf→L. ruminis B. uniformis→ThemeOf→L. ruminis A. muciniphila→ThemeOf→Mecp2ZFN/+ abundance→ThemeOf→A. muciniphila B. uniformis→ThemeOf→Mecp2ZFN/+
223	33562375	5258	Variations in the relative abundance of ASV0360 Lactobacillus acidipiscis (21.65%) and ASV0001 Clostridium metallolevans (11.23%) were primarily responsible for the difference in bacterial community composition in November and January.	ASV0360→ThemeOf→bacterial community composition bacterial community composition→ThemeOf→relative abundance ASV0360→ThemeOf→ASV0001 ASV0001→ThemeOf→ASV0360 ASV0360→ThemeOf→relative abundance ASV0001→ThemeOf→Lactobacillus Lactobacillus→ThemeOf→ASV0360 ASV0001→ThemeOf→bacterial community composition Lactobacillus→ThemeOf→bacterial community composition ASV0001→ThemeOf→relative abundance Lactobacillus→ThemeOf→ASV0001 relative abundance→ThemeOf→ASV0360 Lactobacillus→ThemeOf→relative abundance relative abundance→ThemeOf→Lactobacillus bacterial community composition→ThemeOf→ASV0360 relative abundance→ThemeOf→bacterial community composition bacterial community composition→ThemeOf→Lactobacillus relative abundance→ThemeOf→ASV0001 ASV0360→ThemeOf→Lactobacillus bacterial community composition→ThemeOf→ASV0001
224	33562375	5259	There were ASV0002 L. acidipiscis (12.76%) and ASV0001 Clostridium metallolevans (11.92%) between November and March, and ASV0360 L. acidipiscis (22.93%) between January and March (Table 1).	Clostridium→ThemeOf→ASV0001 Clostridium→ThemeOf→ASV0360 L. acidipiscis Clostridium→ThemeOf→ASV0002 L. acidipiscis ASV0360 L. acidipiscis→ThemeOf→Clostridium ASV0002 L. acidipiscis→ThemeOf→Clostridium ASV0001→ThemeOf→Clostridium
225	33562375	5264	Among the common foods, P. arundinacea, P. annua, R. japonicus, P. supina, and V. natans had an extremely significant correlation with intestinal bacteria, and P. criopolitanum and V. natans had a significant correlation with intestinal potential pathogenic bacteria (Table 2 and Table 3).	P. criopolitanum→ThemeOf→intestinal bacteria intestinal bacteria→ThemeOf→P. criopolitanum
226	33670654	5392	Notably, it was previously demonstrated that, in terms of short chain fatty acid profiles, the 22% OS group had the lowest lactic acid/acetic acid in the FTMR.	lactic acid/acetic acid→ThemeOf→lowest 22% OS→CauseOf→lowest 22% OS→ThemeOf→lactic acid/acetic acid lactic acid/acetic acid→ThemeOf→22% OS
227	33679767	5406	Changes in the composition and structure of the gastrointestinal flora can affect the characteristics and development of the host immune system and even induce a series of central nervous system inflammation events.	composition→ThemeOf→inflammation Changes→ThemeOf→composition inflammation→ThemeOf→induce characteristics→ThemeOf→composition composition→ThemeOf→induce Changes→CauseOf→affect characteristics→ThemeOf→Changes composition→ThemeOf→characteristics affect→CauseOf→induce characteristics→ThemeOf→affect composition→ThemeOf→development of the host immune system inflammation→ThemeOf→composition composition→ThemeOf→Changes inflammation→ThemeOf→Changes development of the host immune system→ThemeOf→induce composition→ThemeOf→affect inflammation→ThemeOf→affect Changes→ThemeOf→inflammation induce→CauseOf→affect development of the host immune system→ThemeOf→composition Changes→CauseOf→induce development of the host immune system→ThemeOf→Changes Changes→ThemeOf→characteristics characteristics→ThemeOf→induce development of the host immune system→ThemeOf→affect Changes→ThemeOf→development of the host immune system
228	33679767	5412	Moreover, including L. acidipiscis enhanced the development of Vgamma1+gammadelta T cells but suppressed that of Vgamma4+gammadelta T cells.	enhanced→CauseOf→suppressed suppressed→CauseOf→enhanced L. acidipiscis→CauseOf→enhanced L. acidipiscis→CauseOf→suppressed
229	33679767	5413	In summary, our results demonstrated the ability of L. acidipiscis to induce generation of regulatory gammadelta T cells that suppress the development of the encephalomyelitic Th1 and Th17 cells and the progress of EAE.	L. acidipiscis→CauseOf→suppress
230	33679767	5418	This model is consistent with the induction method of MS, specifically combining myelin oligodendrocyte glycoprotein residues 35-55 (MOG35-55) with immunostimulant to induce the generation of pathogenic Th1 and Th17 cells.	MOG35-55→CauseOf→induce myelin oligodendrocyte glycoprotein→ThemeOf→induce myelin oligodendrocyte glycoprotein→ThemeOf→MOG35-55 MOG35-55→ThemeOf→myelin oligodendrocyte glycoprotein
231	33679767	5425	In the intestinal epithelial lymphocytes (IELs) of mice, specifically in the duodenum and jejunum, the percentage of T cells consisting of gammadelta T cells was observed to be as high as 70%, much higher than that of alphabeta T cells.	gammadelta T cells→CauseOf→higher
232	33679767	5431	According to the composition of T cell receptors, the peripheral gammadelta T cells in mice can be divided into two main subsets: Vgamma1+ and Vgamma4+.	Vgamma4+→ThemeOf→gammadelta Vgamma1+→ThemeOf→gammadelta gammadelta→ThemeOf→Vgamma4+ gammadelta→ThemeOf→Vgamma1+
233	33679767	5432	However, Vgamma1+ gammadelta T cells have been shown to produce more Th2-type cytokines such as IL-4, while Vgamma4+ gammadelta T cells have been shown to preferentially produce IL-17A.	Vgamma4+ gammadelta T→ThemeOf→IL-4 Vgamma1+ gammadelta T cells→CauseOf→more Vgamma4+ gammadelta T→ThemeOf→IL-17A Vgamma1+ gammadelta T cells→ThemeOf→Th2-type cytokines Vgamma4+ gammadelta T→CauseOf→more Th2-type cytokines→ThemeOf→IL-4 Vgamma4+ gammadelta T→ThemeOf→Th2-type cytokines Th2-type cytokines→ThemeOf→Vgamma4+ gammadelta T IL-17A→ThemeOf→Vgamma4+ gammadelta T Th2-type cytokines→ThemeOf→IL-17A IL-17A→ThemeOf→more Th2-type cytokines→ThemeOf→more IL-4→ThemeOf→Vgamma4+ gammadelta T IL-17A→ThemeOf→Vgamma1+ gammadelta T cells Th2-type cytokines→ThemeOf→Vgamma1+ gammadelta T cells IL-4→ThemeOf→more IL-17A→ThemeOf→Th2-type cytokines IL-4→ThemeOf→Vgamma1+ gammadelta T cells Vgamma1+ gammadelta T cells→ThemeOf→IL-4 IL-4→ThemeOf→Th2-type cytokines Vgamma1+ gammadelta T cells→ThemeOf→IL-17A
234	33679767	5435	In rodent models, discrepancies in gut microbiota were found to be associated with in some cases susceptibility to EAE and other cases resistance to EAE.	EAE→ThemeOf→gut gut→ThemeOf→EAE discrepancies→CauseOf→associated gut→ThemeOf→discrepancies discrepancies→ThemeOf→EAE gut→ThemeOf→susceptibility discrepancies→ThemeOf→susceptibility discrepancies→ThemeOf→gut susceptibility→ThemeOf→associated susceptibility→ThemeOf→EAE EAE→ThemeOf→associated susceptibility→ThemeOf→discrepancies EAE→ThemeOf→discrepancies susceptibility→ThemeOf→gut EAE→ThemeOf→susceptibility gut→ThemeOf→associated
235	33679767	5436	Previous studies from our laboratory showed that CD44 may also regulate inflammation, in as much as CD44 deficiency inhibits proinflammatory Th1 and Th17 cells while promoting CD4+ Th2 and Treg cell differentiation.	inhibits→CauseOf→regulate deficiency→CauseOf→promoting deficiency→CauseOf→regulate promoting→CauseOf→inhibits regulate→CauseOf→inhibits promoting→CauseOf→regulate deficiency→CauseOf→inhibits regulate→CauseOf→promoting inhibits→CauseOf→promoting
236	33679767	5437	In fact, CD44 deficiency led to decreased inflammation and amelioration of an experimental form of EAE.	CD44→ThemeOf→decreased deficiency→CauseOf→amelioration CD44→ThemeOf→amelioration CD44→ThemeOf→deficiency amelioration→CauseOf→decreased deficiency→CauseOf→decreased deficiency→ThemeOf→CD44 decreased→CauseOf→amelioration
237	33679767	5442	In the absence of these regulatory gammadelta T cells, L. acidipiscis did not protect mice from EAE.	L. acidipiscis→CauseOf→not
238	33679767	5470	These encephalitogenic CD4+ T cells were cultured in RPMI1640 medium (Gibco BRL) with 10% FCS and MOG35-55 (30 mug/mL).	MOG35-55→ThemeOf→CD4 encephalitogenic→ThemeOf→CD4 encephalitogenic→ThemeOf→MOG35-55 CD4→ThemeOf→encephalitogenic CD4→ThemeOf→MOG35-55 MOG35-55→ThemeOf→encephalitogenic
239	33679767	5498	The amounts of acetic acid (p < 0.01), n-butyric acid (p < 0.01), i-butyric acid (p < 0.001), propionic acid (p < 0.001), i-valeric acid (p < 0.01) and n-caproic acid (p < 0.05) in the feces of C57BL/6 mice fed with L. acidipiscis were significantly higher than for those fed with E. coli.	n-caproic acid→ThemeOf→higher i-butyric acid→ThemeOf→n-butyric acid propionic acid→ThemeOf→n-caproic acid n-butyric acid→ThemeOf→i-valeric acid L. acidipiscis→ThemeOf→n-caproic acid n-caproic acid→ThemeOf→i-valeric acid i-butyric acid→ThemeOf→amounts of acetic acid propionic acid→ThemeOf→i-butyric acid n-butyric acid→ThemeOf→propionic acid L. acidipiscis→ThemeOf→i-butyric acid n-caproic acid→ThemeOf→propionic acid i-valeric acid→ThemeOf→L. acidipiscis propionic acid→ThemeOf→higher n-butyric acid→ThemeOf→amounts of acetic acid L. acidipiscis→CauseOf→higher n-caproic acid→ThemeOf→n-butyric acid i-valeric acid→ThemeOf→n-caproic acid propionic acid→ThemeOf→i-valeric acid amounts of acetic acid→ThemeOf→L. acidipiscis L. acidipiscis→ThemeOf→i-valeric acid n-caproic acid→ThemeOf→amounts of acetic acid i-valeric acid→ThemeOf→i-butyric acid propionic acid→ThemeOf→n-butyric acid amounts of acetic acid→ThemeOf→n-caproic acid L. acidipiscis→ThemeOf→propionic acid i-butyric acid→ThemeOf→L. acidipiscis i-valeric acid→ThemeOf→higher propionic acid→ThemeOf→amounts of acetic acid amounts of acetic acid→ThemeOf→i-butyric acid L. acidipiscis→ThemeOf→n-butyric acid i-butyric acid→ThemeOf→n-caproic acid i-valeric acid→ThemeOf→propionic acid n-butyric acid→ThemeOf→L. acidipiscis amounts of acetic acid→ThemeOf→higher L. acidipiscis→ThemeOf→amounts of acetic acid i-butyric acid→ThemeOf→higher i-valeric acid→ThemeOf→n-butyric acid n-butyric acid→ThemeOf→n-caproic acid amounts of acetic acid→ThemeOf→i-valeric acid n-caproic acid→ThemeOf→L. acidipiscis i-butyric acid→ThemeOf→i-valeric acid i-valeric acid→ThemeOf→amounts of acetic acid n-butyric acid→ThemeOf→i-butyric acid amounts of acetic acid→ThemeOf→propionic acid n-caproic acid→ThemeOf→i-butyric acid i-butyric acid→ThemeOf→propionic acid propionic acid→ThemeOf→L. acidipiscis n-butyric acid→ThemeOf→higher amounts of acetic acid→ThemeOf→n-butyric acid
240	33679767	5499	Furthermore, the data showed a significant difference (p < 0.001) in the concentration of n-valeric acid between the EAE-WT mice that received E. coli and those receiving L. acidipiscis, indicating that L. acidipiscis could induce protective immunophenotypes by synthesizing acetic acid and other SFCAs in the intestinal tracts of EAE-susceptible mice.	L. acidipiscis→CauseOf→induce L. acidipiscis→CauseOf→acetic acid acetic acid→ThemeOf→induce acetic acid→CauseOf→L. acidipiscis
241	33679767	5504	The production of protective IL-10 and that of IL-13 were each increased, while the production of pathological IFN-gamma and that of IL-17A were each significantly decreased, indicating that L. acidipiscis may regulate the differentiation of cerebrospinal inflammatory CD4+ T cells and induce a deviation of the protective T cell immune response (Figure 4).	induce→CauseOf→deviation induce→CauseOf→regulate L. acidipiscis→CauseOf→induce deviation→CauseOf→induce deviation→CauseOf→regulate L. acidipiscis→CauseOf→regulate regulate→CauseOf→deviation regulate→CauseOf→induce L. acidipiscis→CauseOf→deviation
242	33679767	5512	In addition, the differentiation of Th2 cells was significantly enhanced after they were co-cultured with L. acidipiscis (Figure 6B), whereas the development of Th17 cells was significantly inhibited after they were co-cultured with L. acidipiscis (Figure 6C).	L. acidipiscis→CauseOf→inhibited L. acidipiscis→CauseOf→enhanced
243	33679767	5528	Our results showed that compared with E. coli, L. acidipiscis increased the production of CD4+ FOXP3+ Treg cells, IL-10 and IL-13, and inhibited the production of Th1, Th17, IFN-gamma and IL-17A.	production→ThemeOf→L. acidipiscis IL-17A→ThemeOf→increased IL-10→ThemeOf→increased production of Th1→ThemeOf→L. acidipiscis L. acidipiscis→ThemeOf→CD4 FOXP3→ThemeOf→production of Th1 production→ThemeOf→FOXP3 IL-17A→ThemeOf→L. acidipiscis IL-10→ThemeOf→L. acidipiscis production of Th1→ThemeOf→FOXP3 L. acidipiscis→ThemeOf→IL-17A FOXP3→ThemeOf→inhibited production→ThemeOf→CD4 CD4→ThemeOf→production IL-13→ThemeOf→production production of Th1→ThemeOf→production inhibited→CauseOf→increased L. acidipiscis→ThemeOf→IL-13 FOXP3→ThemeOf→increased production→ThemeOf→IL-17A CD4→ThemeOf→production of Th1 IL-13→ThemeOf→production of Th1 production of Th1→ThemeOf→CD4 IFN-gamma→ThemeOf→production L. acidipiscis→ThemeOf→IL-10 FOXP3→ThemeOf→L. acidipiscis production→ThemeOf→IL-13 CD4→ThemeOf→inhibited IL-13→ThemeOf→inhibited production of Th1→ThemeOf→IL-17A IFN-gamma→ThemeOf→production of Th1 L. acidipiscis→ThemeOf→production of Th1 production→ThemeOf→IL-10 CD4→ThemeOf→increased IL-13→ThemeOf→increased production of Th1→ThemeOf→IL-13 IFN-gamma→ThemeOf→inhibited L. acidipiscis→CauseOf→inhibited production→ThemeOf→production of Th1 CD4→ThemeOf→L. acidipiscis IL-13→ThemeOf→L. acidipiscis production of Th1→ThemeOf→IL-10 IFN-gamma→ThemeOf→increased L. acidipiscis→ThemeOf→IFN-gamma production→ThemeOf→inhibited IL-17A→ThemeOf→production IL-10→ThemeOf→production production of Th1→ThemeOf→inhibited IFN-gamma→ThemeOf→L. acidipiscis L. acidipiscis→CauseOf→increased production→ThemeOf→IFN-gamma IL-17A→ThemeOf→production of Th1 IL-10→ThemeOf→production of Th1 production of Th1→ThemeOf→IFN-gamma increased→CauseOf→inhibited L. acidipiscis→ThemeOf→FOXP3 production→ThemeOf→increased IL-17A→ThemeOf→inhibited IL-10→ThemeOf→inhibited production of Th1→ThemeOf→increased L. acidipiscis→ThemeOf→production FOXP3→ThemeOf→production
244	33679767	5538	While Vgamma1+ gammadelta T cells produce more Th2-type cytokines such as IL-4 and IL-5, Vgamma4+ gammadelta T cells preferentially produce IL-17.	IL-5→ThemeOf→Vgamma1+ gammadelta T IL-17→ThemeOf→Vgamma4+ gammadelta T IL-17→ThemeOf→Vgamma1+ gammadelta T Vgamma1+ gammadelta T→ThemeOf→IL-5 Vgamma1+ gammadelta T→ThemeOf→IL-17 Vgamma1+ gammadelta T→ThemeOf→IL-4 Vgamma4+ gammadelta T→ThemeOf→IL-5 IL-4→ThemeOf→Vgamma4+ gammadelta T Vgamma4+ gammadelta T→ThemeOf→IL-17 IL-4→ThemeOf→Vgamma1+ gammadelta T Vgamma4+ gammadelta T→ThemeOf→IL-4 IL-5→ThemeOf→Vgamma4+ gammadelta T
245	33679767	5540	In this study, we found a negative correlation between L. acidipiscis in the intestinal tract and the progress of EAE.	progress→ThemeOf→L. acidipiscis EAE→ThemeOf→negative EAE→ThemeOf→progress EAE→ThemeOf→L. acidipiscis L. acidipiscis→CauseOf→negative L. acidipiscis→ThemeOf→progress L. acidipiscis→ThemeOf→EAE progress→ThemeOf→negative progress→ThemeOf→EAE
246	33679767	5541	The resistance of CD44KO mice to EAE was related to the stimulation and activation of gammadelta T cells in small intestine epithelial tissues by L. acidipiscis.	gammadelta T→ThemeOf→CD44KO stimulation→CauseOf→activation gammadelta T→ThemeOf→stimulation L. acidipiscis→CauseOf→activation L. acidipiscis→ThemeOf→gammadelta T L. acidipiscis→ThemeOf→CD44KO L. acidipiscis→CauseOf→stimulation CD44KO→ThemeOf→activation activation→CauseOf→stimulation CD44KO→ThemeOf→gammadelta T gammadelta T→ThemeOf→activation CD44KO→ThemeOf→L. acidipiscis gammadelta T→ThemeOf→L. acidipiscis CD44KO→ThemeOf→stimulation
247	33679767	5545	Our results showed a negative correlation between the amount of intestinal L. acidipiscis and the progression of EAE, and showed the regulation of encephalitogenic CD4+ T cell differentiation by L. acidipiscis to be related to gammadelta T cells.	CD4→ThemeOf→L. acidipiscis L. acidipiscis→ThemeOf→gammadelta T CD4→ThemeOf→gammadelta T L. acidipiscis→ThemeOf→EAE CD4→ThemeOf→EAE L. acidipiscis→ThemeOf→CD4 gammadelta T→ThemeOf→L. acidipiscis gammadelta T→ThemeOf→EAE gammadelta T→ThemeOf→CD4 EAE→ThemeOf→L. acidipiscis EAE→ThemeOf→gammadelta T EAE→ThemeOf→CD4
248	33679767	5546	Meanwhile in our experiments, L. acidipiscis suppressed in vitro the proliferation of Th1 and Th17 cells as well as the secretion of IFN-gamma and IL-17A, and clearly promoted the development of Treg and Th2 cells.	L. acidipiscis→CauseOf→suppressed promoted→CauseOf→suppressed suppressed→CauseOf→promoted L. acidipiscis→CauseOf→promoted
249	34045460	5555	The GM byproduct trimethylamine-n-oxide could degrade some circRNAs.	trimethylamine-n-oxide→CauseOf→degrade
250	34045460	5639	After blockade with 5% nonfat dry milk in Tris-buffered saline (20 mM Tris-HCl, 500 mM NaCl, pH 7.4) with 0.2% Tween-20 (T104863; Aladdin, Beijing, China), the PVDF membranes were probed with antibodies overnight at 4 C, followed by incubation with a horseradish peroxidase-conjugated goat anti-mouse (G2211-1-A; Servicebio, Beijing, China) or goat anti-rabbit (G2210-2-A; Servicebio) IgG secondary antibody (1:2000 dilution).	G2211-1-A→ThemeOf→dry milk dry milk→ThemeOf→G2211-1-A dry milk→ThemeOf→G2210-2-A G2210-2-A→ThemeOf→dry milk
251	34045460	5641	The bodyweights of mice fed a HSHF diet were higher than those fed a standard diet (control, p < 0.05) (Fig.	bodyweights→ThemeOf→HSHF bodyweights→ThemeOf→higher HSHF→ThemeOf→bodyweights HSHF→CauseOf→higher
252	34045460	5645	These data suggested that the HSHF diet utilized caused increases in bodyweight, blood glucose level, and TMAO level.	HSHF→CauseOf→increases
253	34045460	5646	Sequencing of the 16 S rRNA gene showed that the HSHF diet significantly decreased the operational taxonomic units (OTUs) of bacteria of the phyla Acidobacteria, Verrucomicrobia, Tenericutes, and Firmicutes, while increasing the OTUs of bacteria of the phyla Bacteroidetes, Proteobacteria, Deferribacteres, Cyanobacteria and Actinobacteria (p < 0.05) (Fig.	HSHF→CauseOf→decreased decreased→CauseOf→increasing increasing→CauseOf→decreased HSHF→CauseOf→increasing
254	34045460	5650	Hence, the HSHF diet could induce dysbacteriosis in mice.	HSHF→ThemeOf→dysbacteriosis HSHF→CauseOf→induce dysbacteriosis→ThemeOf→HSHF dysbacteriosis→ThemeOf→induce
255	34045460	5653	The pathology of the small intestine and colon of mice fed the HSHF diet was different from that of mice fed the standard diet.	colon→ThemeOf→different HSHF→CauseOf→different
256	34045460	5661	S2F) tissues showed that the HSHF diet not only induced dysbacteriosis, but also activated inflammation and damage to multiple organs.	HSHF→CauseOf→activated HSHF→CauseOf→induced activated→CauseOf→induced induced→CauseOf→activated
257	34045460	5676	These data demonstrated that atrophy, inflammation, or the immune response were imbalanced in the brains of mice with HSHF diet-induced dysbacteriosis.	atrophy→ThemeOf→immune response HSHF→ThemeOf→dysbacteriosis dysbacteriosis→ThemeOf→atrophy HSHF→ThemeOf→inflammation dysbacteriosis→ThemeOf→inflammation HSHF→ThemeOf→immune response dysbacteriosis→ThemeOf→HSHF immune response→ThemeOf→atrophy dysbacteriosis→ThemeOf→immune response immune response→ThemeOf→dysbacteriosis inflammation→ThemeOf→atrophy immune response→ThemeOf→inflammation inflammation→ThemeOf→dysbacteriosis immune response→ThemeOf→HSHF atrophy→ThemeOf→dysbacteriosis inflammation→ThemeOf→HSHF atrophy→ThemeOf→inflammation inflammation→ThemeOf→immune response atrophy→ThemeOf→HSHF HSHF→ThemeOf→atrophy
258	34045460	5701	The ACh level in brain tissues was important for the interactions between the brain circRNA of chr5_21278044/21281602_+, chrX_162934286/162941844_+ and chr16_37121798/ 37129964_-, and bacteria from Paraprevotella, Helicobacteraceae, Erysipelotrichaceae, [Ruminococcus] and Streptophyta (Fig.	chr5_21278044/21281602_+→ThemeOf→Erysipelotrichaceae chr5_21278044/21281602_+→ThemeOf→ACh chrX_162934286/162941844_+→ThemeOf→Erysipelotrichaceae chrX_162934286/162941844_+→ThemeOf→ACh ACh→ThemeOf→Erysipelotrichaceae ACh→ThemeOf→chr5_21278044/21281602_+ ACh→ThemeOf→chrX_162934286/162941844_+ Erysipelotrichaceae→ThemeOf→chr5_21278044/21281602_+ Erysipelotrichaceae→ThemeOf→chrX_162934286/162941844_+ Erysipelotrichaceae→ThemeOf→ACh
259	34045460	5719	Levels of some monoamine neurotransmitter were changed in mice fed the HSHF diet (Figs.	HSHF→CauseOf→changed
260	34045460	5741	8Ad), which indicated that energy metabolism was imbalanced due to dysfunction of NADH dehydrogenase activity and oxidoreductase.	dysfunction→ThemeOf→NADH dysfunction→ThemeOf→energy metabolism energy metabolism→ThemeOf→NADH energy metabolism→ThemeOf→dysfunction NADH→ThemeOf→dysfunction NADH→ThemeOf→energy metabolism
261	34045460	5744	In agreement with results from other studies, TMA resulted in negative consequences for the host and, in the present study, TMA led to negative consequences for the nervous system.	TMA→CauseOf→negative TMA→CauseOf→negative
262	34045460	5752	Previously, using in an overexpressed circNF1-419 adeno-associated virus system, we showed that circRNAs in the brain influenced the cholinergic system of the brain, and changed the GM composition, intestinal homeostasis/physiology, and even the GM trajectory in newborn mice.	GM composition→ThemeOf→circRNAs GM trajectory→ThemeOf→intestinal homeostasis/physiology cholinergic system→ThemeOf→changed GM composition→ThemeOf→changed GM trajectory→ThemeOf→influenced circRNAs→ThemeOf→GM composition intestinal homeostasis/physiology→ThemeOf→GM composition GM trajectory→ThemeOf→cholinergic system circRNAs→ThemeOf→intestinal homeostasis/physiology intestinal homeostasis/physiology→ThemeOf→influenced GM trajectory→ThemeOf→circRNAs circRNAs→CauseOf→influenced intestinal homeostasis/physiology→ThemeOf→GM trajectory GM trajectory→ThemeOf→changed circRNAs→ThemeOf→GM trajectory intestinal homeostasis/physiology→ThemeOf→cholinergic system cholinergic system→ThemeOf→GM composition circRNAs→ThemeOf→cholinergic system GM composition→ThemeOf→intestinal homeostasis/physiology intestinal homeostasis/physiology→ThemeOf→circRNAs cholinergic system→ThemeOf→intestinal homeostasis/physiology circRNAs→CauseOf→changed GM composition→ThemeOf→influenced intestinal homeostasis/physiology→ThemeOf→changed cholinergic system→ThemeOf→influenced changed→CauseOf→influenced GM composition→ThemeOf→GM trajectory influenced→CauseOf→changed cholinergic system→ThemeOf→GM trajectory GM composition→ThemeOf→cholinergic system GM trajectory→ThemeOf→GM composition cholinergic system→ThemeOf→circRNAs
263	34045460	5764	Methanogens described in the human microbiota include Euryarchaeota (including M. smithii, M. oralis, M. arbophilus, M. massiliensis, M. luminyensis, M. stadtmanae, Ca.	Euryarchaeota→ThemeOf→M. luminyensis M. luminyensis→ThemeOf→Euryarchaeota M. massiliensis→ThemeOf→Euryarchaeota Euryarchaeota→ThemeOf→M. massiliensis
264	34045460	5769	One clinical investigation showed that a negative association between methane concentrations in breath and anthropometric biomarkers of obesity, and that methane significantly decreased the neurological deficit induced by cerebral ischemia and reperfusion via the antioxidant pathway of PI3K/Akt/HO-1.	methane→CauseOf→breath breath→ThemeOf→cerebral ischemia neurological deficit→ThemeOf→decreased methane→CauseOf→decreased breath→CauseOf→methane neurological deficit→ThemeOf→HO-1 cerebral ischemia→CauseOf→methane methane→CauseOf→neurological deficit breath→ThemeOf→obesity HO-1→ThemeOf→cerebral ischemia cerebral ischemia→ThemeOf→obesity methane→ThemeOf→HO-1 breath→ThemeOf→decreased HO-1→ThemeOf→methane cerebral ischemia→ThemeOf→breath obesity→ThemeOf→cerebral ischemia breath→ThemeOf→neurological deficit HO-1→ThemeOf→obesity cerebral ischemia→ThemeOf→decreased obesity→CauseOf→methane breath→ThemeOf→HO-1 HO-1→ThemeOf→breath cerebral ischemia→ThemeOf→neurological deficit obesity→ThemeOf→breath neurological deficit→ThemeOf→cerebral ischemia HO-1→ThemeOf→decreased cerebral ischemia→ThemeOf→HO-1 obesity→ThemeOf→decreased neurological deficit→CauseOf→methane HO-1→ThemeOf→neurological deficit methane→CauseOf→cerebral ischemia obesity→ThemeOf→neurological deficit neurological deficit→ThemeOf→obesity methane→CauseOf→obesity obesity→ThemeOf→HO-1 neurological deficit→ThemeOf→breath
265	34045460	5785	Neuronal ACh and non-neuronal ACh have been demonstrated to modulate the inflammatory response: ACh protects against C. albicans infection by inhibiting biofilm formation and promoting hemocyte function in a model of Galleria mellonella infection.	ACh→CauseOf→promoting protects→CauseOf→inhibiting inhibiting→CauseOf→protects protects→CauseOf→promoting inhibiting→CauseOf→promoting promoting→CauseOf→protects promoting→CauseOf→inhibiting Galleria mellonella infection→CauseOf→ACh hemocyte function→CauseOf→ACh ACh→CauseOf→biofilm ACh→CauseOf→Galleria mellonella infection biofilm→CauseOf→ACh ACh→CauseOf→protects ACh→CauseOf→hemocyte function ACh→CauseOf→inhibiting
266	34045460	5800	Furthermore, expression of retinoic acid-inducible gene I supported the notion that too much of a HSHF diet affects immunity and increases the risk of virus invasion (p < 0.05) (Fig.	affects→CauseOf→increases increases→CauseOf→affects retinoic acid-inducible gene I→ThemeOf→increases too→CauseOf→increases retinoic acid-inducible gene I→ThemeOf→too too→CauseOf→affects retinoic acid-inducible gene I→ThemeOf→affects too→ThemeOf→retinoic acid-inducible gene I
267	34045460	5812	S5), including Butyrivibrio hungatei, Anaerostipes hadrus, Butyrivibrio proteoclasticus, Blautia sp.	Butyrivibrio proteoclasticus→ThemeOf→Blautia Anaerostipes→ThemeOf→Blautia Butyrivibrio→CauseOf→Blautia Blautia→CauseOf→Butyrivibrio Blautia→ThemeOf→Butyrivibrio proteoclasticus Blautia→ThemeOf→Anaerostipes
268	34074340	5879	Because alleles at lower frequencies are less informative for association analysis, we retained only SNPs with minor allele frequencies (MAFs) above 5% and kept only SNPs that occurred in more than 95% of individuals.	MAF→CauseOf→SNPs SNPs→CauseOf→MAF
269	34074340	5893	The covariates included the top five host genetic principal components and first three principal components of significant and suggestive significant SNPs associated with RFI.	SNPs→ThemeOf→RFI RFI→ThemeOf→SNPs
270	34074340	5907	The most significant SNP controlling the relative abundance of Parabacteroides was rs10730843 (Fig.	Parabacteroides→ThemeOf→controlling Parabacteroides→ThemeOf→rs10730843 rs10730843→ThemeOf→relative abundance rs10730843→ThemeOf→Parabacteroides rs10730843→CauseOf→controlling relative abundance→ThemeOf→controlling relative abundance→ThemeOf→rs10730843
271	34074340	5909	The substitution of G to A for rs10730843 resulted in a significantly increased abundance of cecal Parabacteroides (Fig.	rs10730843→CauseOf→increased
272	34074340	5913	Chickens with the TT genotype of rs314988200 had a higher abundance of cecal Megasphaera (0.19%) than those with the CT and CC genotypes (0.12% and 0.07%, respectively; Fig.	cecal Megasphaera→ThemeOf→abundance cecal Megasphaera→ThemeOf→rs314988200 cecal Megasphaera→ThemeOf→higher abundance→ThemeOf→rs314988200 abundance→ThemeOf→higher abundance→ThemeOf→cecal Megasphaera rs314988200→ThemeOf→abundance rs314988200→CauseOf→higher rs314988200→ThemeOf→cecal Megasphaera
273	34074340	5918	We found that 4 suggestive significant SNPs were related to RFI (Fig.	SNPs→ThemeOf→RFI SNPs→CauseOf→related RFI→ThemeOf→SNPs RFI→ThemeOf→related
274	34074340	5919	Among them, rs313164887 and rs312419026 resided in the intronic region of ELOVL fatty acid elongase 2 (ELOVL2) and phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 (PREX1), respectively.	rs313164887→ThemeOf→ELOVL fatty acid elongase 2 rs312419026→ThemeOf→ELOVL fatty acid elongase 2 ELOVL fatty acid elongase 2→ThemeOf→rs312419026 ELOVL fatty acid elongase 2→ThemeOf→rs313164887
275	34074340	5920	The other two variations, rs317782869 and rs316904613, were near the gene transient receptor potential cation channel subfamily A member 1 (TRPA1) and PREX1, respectively.	PREX1→ThemeOf→rs317782869 variations→ThemeOf→TRPA1 rs317782869→ThemeOf→TRPA1 variations→ThemeOf→PREX1 rs317782869→ThemeOf→PREX1 rs316904613→ThemeOf→TRPA1 rs316904613→ThemeOf→PREX1 TRPA1→ThemeOf→variations TRPA1→ThemeOf→rs316904613 TRPA1→ThemeOf→rs317782869 PREX1→ThemeOf→variations PREX1→ThemeOf→rs316904613
276	34074340	5921	In particular, rs316904613 and rs312419026 were highly linked to each other.	rs316904613→CauseOf→linked rs312419026→CauseOf→linked
277	34074340	5923	The variation in rs317782869 resulted from a base transversion (A/C).	variation→CauseOf→resulted from variation→ThemeOf→base transversion rs317782869→CauseOf→resulted from rs317782869→ThemeOf→base transversion base transversion→ThemeOf→rs317782869 base transversion→ThemeOf→resulted from base transversion→ThemeOf→variation
278	34074340	5925	Regarding the SNP rs316904613, the G to C substitution led to a significant decrease in the RFI value (Fig.	G to C→ThemeOf→RFI G to C→CauseOf→decrease RFI→ThemeOf→G to C RFI→ThemeOf→decrease
279	34074340	5927	Ileal Janthinobacterium and duodenal unclassified Peptostreptococcaceae were close to the significance level at the SNPs of rs313164887 and rs317782869, receptively (Fig.	rs313164887→ThemeOf→Peptostreptococcaceae rs317782869→ThemeOf→Peptostreptococcaceae Peptostreptococcaceae→ThemeOf→rs313164887 Peptostreptococcaceae→ThemeOf→rs317782869
280	34074340	5959	A recent study identified several genetic variants involved in the immune response and metabolism that were significantly associated with microbial diversity in the cecum of chickens.	variants→ThemeOf→microbial variants→CauseOf→associated microbial→ThemeOf→variants microbial→ThemeOf→associated
281	34074340	5975	We then identified three suggestive significant loci:rs317782869, rs313164887, and rs316904613:which were near or distributed on three independent genes: TRPA1, ELOVL2, and PREX1.	rs313164887→ThemeOf→TRPA1 rs317782869→ThemeOf→ELOVL2 rs313164887→ThemeOf→ELOVL2 rs317782869→ThemeOf→PREX1 rs313164887→ThemeOf→PREX1 ELOVL2→ThemeOf→rs316904613 rs316904613→ThemeOf→TRPA1 ELOVL2→ThemeOf→rs313164887 rs316904613→ThemeOf→ELOVL2 ELOVL2→ThemeOf→rs317782869 rs316904613→ThemeOf→PREX1 PREX1→ThemeOf→rs316904613 TRPA1→ThemeOf→rs316904613 PREX1→ThemeOf→rs313164887 TRPA1→ThemeOf→rs313164887 PREX1→ThemeOf→rs317782869 TRPA1→ThemeOf→rs317782869 rs317782869→ThemeOf→TRPA1
282	34074340	5986	A significant difference in RFI was found among chicken individuals differing at specific genetic loci: rs317782869, rs313164887, and rs316904613.	rs317782869→ThemeOf→RFI RFI→ThemeOf→rs317782869 RFI→ThemeOf→rs316904613 RFI→ThemeOf→rs313164887 rs316904613→ThemeOf→RFI rs313164887→ThemeOf→RFI
283	34074340	6012	Our study strengthens the notion that both host genetic and gut microbial variations can lead to variation in feed efficiency.	variations→CauseOf→lead to variation
284	34526973	6026	Moreover, Dajiang samples also contained abundant Pseudomonas, and Brevundimonas spp., while Halomonas, Staphylococcus, Lysinibacillus, Enterobacter, Streptococcus, Acinetobacter, and Halanaerobium spp.	Halomonas→ThemeOf→Pseudomonas Pseudomonas→ThemeOf→Halomonas
285	34526973	6043	Specifically, reported that Lactobacillus sakei, Pediococcus acidilactici, and Weissella thailandensis significantly impact the quality of fermented sausage, while their metabolites provide a flavour profile.	Weissella→CauseOf→impact
286	34526973	6091	At the genera level (Figure 4C), Bacillus, Lactobacillus, Tetragenococcus, and Weissella were the most abundant in the two groups.	Tetragenococcus→ThemeOf→abundant Tetragenococcus→ThemeOf→Weissella Weissella→CauseOf→abundant Weissella→ThemeOf→Lactobacillus Weissella→ThemeOf→Tetragenococcus Weissella→ThemeOf→Bacillus Bacillus→ThemeOf→abundant Bacillus→ThemeOf→Weissella Lactobacillus→ThemeOf→abundant Lactobacillus→ThemeOf→Weissella
287	34530890	6219	The maximum hydrogen yields of the strain isolated from green waste were higher than those previously reported in the literature for other hydrogen-producing bacteria like C. perfringens 130 +- 3 mL of H2 per g of glucose; C. butyricum 136 +- 5 mL of H2 per g of glucose; C. diolis 150 mL of H2 per g of glucose; C. beijerinckii Fanp3 231 mL of H2 per g of glucose and C. tyrobutyricum JM1 223 ml of H2 per g of hexose.	C. beijerinckii→CauseOf→higher
288	34530890	6233	Here, the gene expression modulation in time of the seven genes encoding for [FeFe]-hydrogenase enzymes with different structure types was investigated by RT-qPCR in the hydrogen-producing real biomasses waste, hence in presence of the autochthonous strains, both for the non-producers and the hydrogen-producing strains, either with applied bio-augmentation or not.	RT-qPCR→CauseOf→modulation RT-qPCR→ThemeOf→gene expression gene expression→ThemeOf→modulation gene expression→ThemeOf→RT-qPCR
289	34530890	6260	During the first 23 h of dark fermentation, transcription levels of the genes encoding for the monomeric Cbei_1773 and the heterotrimeric Cbei_4110 [FeFe]-hydrogenases followed the same trend observed for hydrogen production; transcription levels of the gene encoding for monomeric Cbei_0327 showed a reverse trend compared with that of hydrogen.	monomeric Cbei_0327→ThemeOf→transcription transcription→ThemeOf→transcription monomeric Cbei_0327→ThemeOf→Cbei_1773 transcription→ThemeOf→monomeric Cbei_0327 monomeric Cbei_0327→ThemeOf→transcription transcription→ThemeOf→Cbei_1773 Cbei_1773→ThemeOf→transcription transcription→ThemeOf→Cbei_0327 Cbei_1773→ThemeOf→monomeric Cbei_0327 Cbei_1773→ThemeOf→Cbei_0327 transcription→ThemeOf→monomeric Cbei_0327 Cbei_1773→ThemeOf→transcription transcription→ThemeOf→Cbei_1773 Cbei_0327→ThemeOf→transcription transcription→ThemeOf→Cbei_0327 Cbei_0327→ThemeOf→Cbei_1773 transcription→ThemeOf→transcription Cbei_0327→ThemeOf→transcription
290	34530890	6262	A relatively high hydrogen production level has been reported in Clostridia even at low transcripts amounts, given the good stability of the [FeFe] hydrogenases as active enzymes in the cell, which could explain the relatively high hydrogen accumulation between 23 and 144 h even with low transcripts detected at 72 and 144 h. In summary genes Cbei_1773, Cbei_4110, Cbei_0327 and Cbei_1901, which undergo larger changes in expression, seem to be related to hydrogen production, although with positive (Cbei_1773 and Cbei_4110) or negative (Cbei_0327) correlations, hence it would be interesting to further investigate their metabolic roles.	Cbei_1773→CauseOf→related Cbei_1773→ThemeOf→hydrogen production Cbei_1773→CauseOf→related Cbei_1773→ThemeOf→hydrogen production hydrogen production→ThemeOf→related Cbei_4110→CauseOf→related hydrogen production→ThemeOf→Cbei_1773 Cbei_4110→ThemeOf→hydrogen production hydrogen production→ThemeOf→Cbei_1773 Cbei_4110→CauseOf→related hydrogen production→ThemeOf→Cbei_4110 Cbei_4110→ThemeOf→hydrogen production hydrogen production→ThemeOf→Cbei_4110 Cbei_0327→CauseOf→related hydrogen production→ThemeOf→Cbei_0327 Cbei_0327→ThemeOf→hydrogen production
291	34530890	6263	In particular, the positive correlation of hydrogen production with Cbei_1773 is relevant given the attested good productivity and the oxygen-tolerance unique feature of the hydrogenase encoded by this gene.	hydrogen production→ThemeOf→positive hydrogen production→ThemeOf→Cbei_1773 Cbei_1773→CauseOf→positive Cbei_1773→ThemeOf→hydrogen production
292	34530890	6264	Genes Cbei_4000 and Cbei_3796 are possibly less related to hydrogen production and might be silent during dark fermentation.	Cbei_4000→ThemeOf→hydrogen production Cbei_4000→CauseOf→less Cbei_4000→CauseOf→related Cbei_3796→ThemeOf→hydrogen production hydrogen production→ThemeOf→less Cbei_3796→CauseOf→less hydrogen production→ThemeOf→related Cbei_3796→CauseOf→related hydrogen production→ThemeOf→Cbei_4000 hydrogen production→ThemeOf→Cbei_3796 less→CauseOf→related related→CauseOf→less
293	34771152	6422	Furthermore, we divided the cobalamin biosynthetic pathways into three:aerobic and anaerobic biosynthesis of cob(II)yrinate a,c-diamide and biosynthesis of cobalamin from cob(II)yrinate a,c-diamide.	biosynthesis→CauseOf→cob biosynthesis→CauseOf→cob cob→CauseOf→biosynthesis cob→CauseOf→biosynthesis cob→CauseOf→biosynthesis cob→CauseOf→biosynthesis biosynthesis→ThemeOf→biosynthesis biosynthesis→CauseOf→cob biosynthesis→CauseOf→cob biosynthesis→ThemeOf→biosynthesis
294	34771152	6429	In the studied the BC metagenome analysis showed that 32 PEGs were involved in the major biosynthetic pathways of tetrapyrrole cofactor (Table S2).	PEGs→CauseOf→involved
295	34771152	6436	In the metagenome of BC, PEGs of all enzymes involved in the biosynthesis of uroporphyrinogen III using L-glutamate as the starting substrate were detected.	uroporphyrinogen III→ThemeOf→PEGs PEGs→ThemeOf→uroporphyrinogen III
296	34771152	6439	The metagenomic analysis of the study showed the presence of PEGs of both enzymes.	PEGs→CauseOf→presence
297	34771152	6441	In the studied BC, the PEG of the HemD enzyme was observed, but the matching PSs were not detected.	PEG→CauseOf→observed
298	34771152	6449	The metagenomic analysis of the study showed the presence of PEGs of all enzymes, and metaproteomic analysis showed eight PSs matching both enzymes.	PEGs→CauseOf→presence
299	34771152	6452	The metagenome of BC analyzed in this study showed the presence of PEG of HemE and four PSs matching the enzyme.	PEG→CauseOf→presence
300	34771152	6454	The presence of PEGs of both enzymes and one PSs matching HemF and four PSs matching HemN were detected in analyses in the studied BC.	PEGs→ThemeOf→PSs matching HemF PEGs→CauseOf→presence HemN→ThemeOf→PSs matching HemF HemN→ThemeOf→presence HemN→ThemeOf→PEGs PSs matching HemF→ThemeOf→HemN PSs matching HemF→ThemeOf→presence PSs matching HemF→ThemeOf→PEGs PEGs→ThemeOf→HemN
301	34771152	6456	In the BC metagenome, only PEGs of the latter enzyme HemJ were detected, whereas no PSs matching the enzyme HemJ were identified.	PEGs→ThemeOf→HemJ HemJ→ThemeOf→PEGs
302	34771152	6460	The study results showed the presence of PEGs of both enzymes; however, four PSs matching only enzyme Cox15 were detected.	Cox15→ThemeOf→presence PEGs→CauseOf→presence PEGs→ThemeOf→enzyme Cox15 PEGs→ThemeOf→Cox15 enzyme Cox15→ThemeOf→PEGs enzyme Cox15→ThemeOf→presence Cox15→ThemeOf→PEGs
303	34771152	6465	The results of this study showed PEG of HemH and five PSs of this enzyme in the investigated BC.	HemH→ThemeOf→PEG PEG→ThemeOf→HemH
304	34771152	6466	Further, decarboxylation of Fe-coproporphyrin III substituents by hydrogen peroxide-dependent heme synthase (HemQ) or AdoMet-dependent heme synthase (Ahbd) results in the formation of heme B.	heme B→ThemeOf→decarboxylation heme B→ThemeOf→formation Ahbd→ThemeOf→decarboxylation Ahbd→ThemeOf→heme B Ahbd→ThemeOf→formation decarboxylation→ThemeOf→Ahbd decarboxylation→ThemeOf→heme B decarboxylation→CauseOf→formation heme B→ThemeOf→Ahbd
305	34771152	6467	The results showed PEG matching only HemQ enzyme in the studied BC, whereas no PSs matching the enzyme HemQ or Ahbd were detected.	PEG→ThemeOf→HemQ HemQ→ThemeOf→PEG
306	34771152	6471	In the investigated BC, only PEG of Ahbab was detected, but no PSs of any of these enzymes were found.	PEG→ThemeOf→Ahbab Ahbab→ThemeOf→PEG
307	34771152	6476	Metagenomic results of this study showed only PEG of HemQ; however, no PSs matching HemQ or Ahbd enzyme were detected.	PEG→ThemeOf→HemQ PEG→ThemeOf→Ahbd HemQ→ThemeOf→PEG Ahbd→ThemeOf→PEG
308	34771152	6481	The results showed that only PEGs of CbiK and CobN were involved in anaerobic and aerobic pathways, respectively, and the metaproteome of BC had two PSs matching CobB-CbiA.	CobN→ThemeOf→PEGs PEGs→ThemeOf→CobN CobN→ThemeOf→metaproteome PEGs→CauseOf→involved CobN→ThemeOf→involved PEGs→ThemeOf→CbiK CbiK→ThemeOf→PEGs CbiK→ThemeOf→metaproteome metaproteome→ThemeOf→CobN CbiK→ThemeOf→involved metaproteome→ThemeOf→CbiK
309	34771152	6484	Cobalamin formation reactions can be carried out by using cob(II)yrinate a,c-diamide or cob(I)yrinate a, c diamide to form adenosyl cobyrinate a, c diamide.	cob→CauseOf→adenosyl cobyrinate a adenosyl cobyrinate a→CauseOf→cob
310	34771152	6490	The PEG of CobQ was detected in this study, but the PS matching this enzyme was not found in the investigated BC.	PEG→ThemeOf→CobQ CobQ→ThemeOf→PEG
311	34771152	6493	The results of this study showed PEG of CbiB, but PS matching this enzyme was not detected in the BC.	PEG→ThemeOf→CbiB CbiB→ThemeOf→PEG
312	34771152	6496	This study showed PEG of CobP and five PSs matching this enzyme.	PEG→ThemeOf→CobP CobP→ThemeOf→PEG
313	34771152	6505	The results showed PEG of PhpB, but PSs matching this enzyme were absent.	PhpB→ThemeOf→absent PhpB→ThemeOf→PEG PEG→ThemeOf→PhpB PEG→CauseOf→absent
314	34771152	6507	PEGs of TonB, ExbB, and ExbD were identified in the BC metagenome.	PEGs→ThemeOf→TonB TonB→ThemeOf→PEGs
315	34771152	6522	For example, 66% of PEGs and 33% of PSs were identified in the coproporphyrin-dependent pathway of heme biosynthesis.	PEGs→ThemeOf→coproporphyrin-dependent coproporphyrin-dependent→ThemeOf→PEGs
316	34771152	6557	According to a study by Lawrence et al., cob(II)yrinate diamide may be extracted from the medium and converted to cobalamin.	cob→CauseOf→cobalamin cobalamin→CauseOf→cob cobalamin→ThemeOf→converted cob→CauseOf→converted
317	34771152	6560	Various studies have shown that CobB-CbiA is utilized in the acetylation of proteins in the metabolism of microorganisms.	CobB-CbiA→ThemeOf→acetylation acetylation→ThemeOf→CobB-CbiA
318	34991191	9126	CSI, L. helveticus, and L. paralimentarius accelerated the decline of silage pH.	L. paralimentarius→CauseOf→accelerated
319	34991191	9128	Silage inoculated with L. paralimentarius produced less acetic acid and butyric acid.	L. paralimentarius→CauseOf→less
320	34991191	9158	Similar results were observed in the major bacterial genera in all FTMRs belonging to Lactobacillus, covering more than 85% relative abundance, while Weissella, Pediococcus, Bacillus, Geobacillus, Staphylococcus, Paenibacillus, Erwinia, Xanthomonas, and Corynebacterium occupied the remaining portion (Figure 1a).	Weissella→ThemeOf→Geobacillus Weissella→ThemeOf→Erwinia Bacillus→ThemeOf→Weissella Geobacillus→ThemeOf→Weissella Erwinia→ThemeOf→Weissella Weissella→ThemeOf→Bacillus
321	34991191	9185	In the current selected FTMRs, the dominant bacteria during ensiling belonged to the phylum Firmicute, comprising genera Lactobacillus, Lactococcus, Weissella, and Leuconostoc, while Lactobacillus exceeded 85% relative abundance.	Lactobacillus→ThemeOf→Weissella Weissella→ThemeOf→Leuconostoc Weissella→ThemeOf→Lactococcus Weissella→ThemeOf→Lactobacillus Leuconostoc→ThemeOf→Weissella Lactococcus→ThemeOf→Weissella
322	34991191	9190	However, L. pontis (DSM 8475) was eliminated from the list during ensiling because of its slow growth.	L. pontis→ThemeOf→eliminated L. pontis→ThemeOf→DSM 8475 DSM 8475→ThemeOf→L. pontis DSM 8475→CauseOf→eliminated
323	34991191	9215	The current study supports the hypothesis that the homofermentative strain L. paralimentarius accelerated the decrease in pH values of corn stover silage.	L. paralimentarius→ThemeOf→pH values of corn stover silage L. paralimentarius→CauseOf→accelerated accelerated→CauseOf→decrease decrease→CauseOf→accelerated pH values of corn stover silage→ThemeOf→decrease pH values of corn stover silage→ThemeOf→L. paralimentarius pH values of corn stover silage→ThemeOf→accelerated L. paralimentarius→CauseOf→decrease
324	34991191	9224	Similar to the effects of CSI, L. paralimentarius was highly effective in reducing the pH value and producing lactic acid in corn stover silage, which indicated that L. paralimentarius may be a promising ensiling inoculant for corn stover silage.	L. paralimentarius→CauseOf→lactic acid L. paralimentarius→CauseOf→pH value lactic acid→ThemeOf→reducing lactic acid→ThemeOf→pH value lactic acid→CauseOf→L. paralimentarius pH value→ThemeOf→reducing pH value→ThemeOf→lactic acid pH value→CauseOf→L. paralimentarius L. paralimentarius→CauseOf→reducing
325	35010147	6842	According to the report of Zhanggen et al., Lactobacillus and Pediococcus are the dominant bacterial genus in Suancai, which includes species such as Pediococcus parvulus, Loigolactobacillus coryniformis, Lactiplantibacillus pentosus, and Levilactobacillus parabrevis.	Pediococcus→CauseOf→Levilactobacillus Pediococcus→CauseOf→Lactiplantibacillus pentosus Levilactobacillus→CauseOf→Pediococcus Lactiplantibacillus pentosus→CauseOf→Pediococcus
326	35010147	6868	As displayed in Figure 1, the pH values of the four traditionally fermented vegetable samples ranged from 3.33 to 7.10, with PBN samples having the lowest pH value, and significantly lowered than SFWC samples.	lowered→CauseOf→lowest pH value→ThemeOf→lowered PBN→CauseOf→lowest pH value→ThemeOf→PBN PBN→CauseOf→lowered pH value→ThemeOf→pH values PBN→ThemeOf→pH values PBN→ThemeOf→pH value pH values→ThemeOf→lowest pH values→ThemeOf→lowered pH values→ThemeOf→PBN pH values→ThemeOf→pH value lowest→CauseOf→lowered pH value→ThemeOf→lowest
327	35010147	6884	The abundance of Cyanobacteria was relatively higher in SFWC (82.6%), followed by PP (40.6%), PC (38.1%), and PBN (3.8%).	abundance→ThemeOf→SFWC abundance→ThemeOf→higher Cyanobacteria→ThemeOf→SFWC Cyanobacteria→ThemeOf→higher Cyanobacteria→ThemeOf→abundance SFWC→ThemeOf→Cyanobacteria SFWC→CauseOf→higher SFWC→ThemeOf→abundance abundance→ThemeOf→Cyanobacteria
328	35010147	6891	However, Lactobacillus was not detected in SFWC samples, while Weissella was the predominant genus in SFWC samples (7.7%).	Lactobacillus→ThemeOf→Weissella Weissella→ThemeOf→Lactobacillus
329	35010147	6893	In addition, Salinivibrio, Weissella, Arcobacter, Halomonas, and Terasakiispira were more abundant in PBN samples.	Terasakiispira→ThemeOf→PBN Halomonas→ThemeOf→Arcobacter Terasakiispira→ThemeOf→Arcobacter Halomonas→ThemeOf→Weissella Terasakiispira→ThemeOf→Weissella Weissella→CauseOf→abundant Arcobacter→ThemeOf→abundant Weissella→ThemeOf→PBN PBN→ThemeOf→abundant Arcobacter→ThemeOf→PBN Weissella→ThemeOf→Terasakiispira PBN→ThemeOf→Terasakiispira Arcobacter→ThemeOf→Terasakiispira Weissella→ThemeOf→Arcobacter PBN→ThemeOf→Arcobacter Arcobacter→ThemeOf→Halomonas Weissella→ThemeOf→Halomonas PBN→ThemeOf→Halomonas Arcobacter→ThemeOf→Weissella PBN→ThemeOf→Weissella Halomonas→ThemeOf→abundant Terasakiispira→ThemeOf→abundant Halomonas→ThemeOf→PBN
330	35010147	6908	Tartaric acid had the greatest effect on the bacterial composition, followed by malic acid, TA, and lactic acid.	lactic→ThemeOf→effect lactic→ThemeOf→Tartaric bacterial composition→ThemeOf→effect bacterial composition→ThemeOf→Tartaric Tartaric→CauseOf→effect Tartaric→ThemeOf→lactic Tartaric→ThemeOf→bacterial composition
331	35010147	6947	This is the first study to report that tartaric acid and malic acid affect the structure of bacterial communities in fermented vegetables.	tartaric→CauseOf→affect
332	35010147	6950	Thus, it is necessary to explore the influence of tartaric acid and malic acid on microbial communities in the production of SFWC and PBN samples.	tartaric→CauseOf→influence
333	35010187	6971	Thirteen kinds of VOCs were different between the two raw materials and the correlation between the microorganisms and VOCs showed that cabbage paocai had stronger correlations than radish paocai for the most significant relationship between 4-isopropylbenzyl alcohol, alpha-cadinol, terpinolene and isobutyl phenylacetate.	terpinolene→ThemeOf→stronger cabbage→CauseOf→stronger isobutyl phenylacetate→ThemeOf→stronger terpinolene→ThemeOf→4-isopropylbenzyl alcohol cabbage→ThemeOf→terpinolene isobutyl phenylacetate→ThemeOf→terpinolene terpinolene→ThemeOf→cabbage cabbage→ThemeOf→4-isopropylbenzyl alcohol isobutyl phenylacetate→ThemeOf→4-isopropylbenzyl alcohol terpinolene→ThemeOf→alpha-cadinol cabbage→ThemeOf→alpha-cadinol isobutyl phenylacetate→ThemeOf→cabbage terpinolene→ThemeOf→isobutyl phenylacetate cabbage→ThemeOf→isobutyl phenylacetate isobutyl phenylacetate→ThemeOf→alpha-cadinol 4-isopropylbenzyl alcohol→ThemeOf→stronger alpha-cadinol→ThemeOf→stronger 4-isopropylbenzyl alcohol→ThemeOf→terpinolene alpha-cadinol→ThemeOf→terpinolene 4-isopropylbenzyl alcohol→ThemeOf→cabbage alpha-cadinol→ThemeOf→4-isopropylbenzyl alcohol 4-isopropylbenzyl alcohol→ThemeOf→alpha-cadinol alpha-cadinol→ThemeOf→cabbage 4-isopropylbenzyl alcohol→ThemeOf→isobutyl phenylacetate alpha-cadinol→ThemeOf→isobutyl phenylacetate
334	35010187	7027	Among these, linalool registered the highest proportions reaching up to 35% and 41.6% in the red radish and cabbage paocais, respectively, similar to previous studies.	linalool→CauseOf→highest
335	35010187	7029	Other alcohols were also evaluated to have a positive effect on paocai's flavor with alpha-terpineol contributing a floral typically lilac odor; eucalyptol with a eucalyptus, herbal and camphor odor; and nerol with notes of roses.	eucalyptol→CauseOf→contributing alpha-terpineol→CauseOf→contributing
336	35010187	7034	Among the sulfides, dimethyl disulfide and dimethyl trisulfide were uniquely found in the red radish paocai, whereas 3-butenylisothiocyanate was found to be the unique sulfide in the cabbage paocai.	dimethyl→CauseOf→found dimethyl→CauseOf→dimethyl trisulfide dimethyl trisulfide→CauseOf→dimethyl dimethyl trisulfide→ThemeOf→found
337	35052575	7084	To better decipher the systems-based link between the metal-microbiome-gut-brain axis, it is important to interpret how microbial dysbiosis, in relation to oxidative stress from metals, leads to a pro-inflammatory environment and how the gut microbiome influences the remediation of xenobiotic metals.	gut→ThemeOf→leads to remediation→ThemeOf→gut gut→ThemeOf→leads to dysbiosis→ThemeOf→gut gut→ThemeOf→dysbiosis remediation→ThemeOf→microbial gut→ThemeOf→dysbiosis dysbiosis→ThemeOf→influences gut→ThemeOf→pro-inflammatory remediation→ThemeOf→gut gut→ThemeOf→pro-inflammatory dysbiosis→ThemeOf→leads to microbial→ThemeOf→gut remediation→ThemeOf→influences influences→CauseOf→leads to dysbiosis→ThemeOf→pro-inflammatory microbial→ThemeOf→remediation remediation→ThemeOf→leads to influences→CauseOf→pro-inflammatory pro-inflammatory→CauseOf→influences microbial→ThemeOf→gut remediation→ThemeOf→dysbiosis leads to→CauseOf→influences pro-inflammatory→CauseOf→leads to microbial→CauseOf→influences remediation→ThemeOf→pro-inflammatory leads to→CauseOf→pro-inflammatory gut→ThemeOf→microbial microbial→CauseOf→leads to gut→ThemeOf→microbial dysbiosis→ThemeOf→gut gut→ThemeOf→remediation microbial→ThemeOf→dysbiosis gut→ThemeOf→remediation dysbiosis→ThemeOf→microbial gut→ThemeOf→influences microbial→CauseOf→pro-inflammatory gut→ThemeOf→influences dysbiosis→ThemeOf→remediation
338	35052575	7093	Improper metal binding associated with oxidative stress leads to protein misfolding and aggregation.	Improper→ThemeOf→binding Improper→CauseOf→leads to binding→ThemeOf→leads to binding→ThemeOf→Improper
339	35052575	7095	Protein misfolding is the hallmark of numerous neurodegenerative diseases such as Alzheimer's Disease, Lewy Body Dementia, Huntington's Disease, and prion diseases, and is similarly underlined with metal stress.	misfolding→ThemeOf→Protein Alzheimer's Disease→ThemeOf→misfolding misfolding→ThemeOf→Huntington's Disease misfolding→ThemeOf→Alzheimer's Disease Lewy Body Dementia→ThemeOf→misfolding misfolding→ThemeOf→prion diseases Huntington's Disease→ThemeOf→misfolding hallmark of numerous neurodegenerative diseases→ThemeOf→misfolding prion diseases→ThemeOf→misfolding misfolding→ThemeOf→hallmark of numerous neurodegenerative diseases Protein→ThemeOf→misfolding misfolding→ThemeOf→Lewy Body Dementia
340	35052575	7101	Different valence states or species of Mn (Mn2+ or Mn3+) play significant roles in Mn neurotoxicity, in which Mn3+ is more toxic than Mn2+.	neurotoxicity→CauseOf→Mn3+ Mn3+→CauseOf→neurotoxicity
341	35052575	7119	The dysregulation of dopamine transmission from the substantia nigra to the striatum, a region associated with motor symptoms in Mn neurotoxicity, is known to prevent dopamine release, thereby leading to elicit behavioral responses that are similar to both PD and Mn neurotoxicity.	neurotoxicity→ThemeOf→prevent neurotoxicity→ThemeOf→dopamine transmission dopamine transmission→ThemeOf→leading dysregulation→ThemeOf→neurotoxicity neurotoxicity→ThemeOf→elicit neurotoxicity→ThemeOf→dopamine release dopamine release→ThemeOf→prevent dysregulation→ThemeOf→neurotoxicity neurotoxicity→ThemeOf→neurotoxicity neurotoxicity→ThemeOf→dysregulation dopamine release→ThemeOf→elicit dysregulation→ThemeOf→dopamine transmission neurotoxicity→ThemeOf→dopamine transmission neurotoxicity→ThemeOf→leading dopamine release→ThemeOf→neurotoxicity dysregulation→ThemeOf→dopamine release neurotoxicity→ThemeOf→dopamine release dopamine transmission→ThemeOf→prevent dopamine release→ThemeOf→neurotoxicity dysregulation→CauseOf→leading neurotoxicity→ThemeOf→dysregulation dopamine transmission→ThemeOf→elicit dopamine release→ThemeOf→dopamine transmission leading→CauseOf→prevent prevent→CauseOf→elicit neurotoxicity→ThemeOf→leading dopamine transmission→ThemeOf→neurotoxicity dopamine release→ThemeOf→dysregulation leading→CauseOf→elicit prevent→CauseOf→leading neurotoxicity→ThemeOf→prevent dopamine transmission→ThemeOf→neurotoxicity dopamine release→ThemeOf→leading elicit→CauseOf→prevent neurotoxicity→ThemeOf→elicit dopamine transmission→ThemeOf→dopamine release dysregulation→CauseOf→prevent elicit→CauseOf→leading neurotoxicity→ThemeOf→neurotoxicity dopamine transmission→ThemeOf→dysregulation dysregulation→CauseOf→elicit
342	35052575	7132	Hg differs from other metals with regard to cellular transport; it does not require human macrophages or other immuno-transport mechanisms, rather MeHg is readily able to penetrate the blood-brain barrier (BBB).	MeHg→CauseOf→penetrate age→ThemeOf→MeHg age→ThemeOf→penetrate MeHg→ThemeOf→age
343	35052575	7139	Through these pathomechanisms, MeHg exposure leads to apoptosis and neurotoxicity through dysfunctional cell narrowing, chromatin condensation, the modification of cytochrome C flux, and well-described oxidative stress insults to the mitochondria.	MeHg→CauseOf→modification leads to→CauseOf→modification MeHg→CauseOf→leads to modification→CauseOf→leads to
344	35052575	7156	Irregularities in the regulation of this gene lead to chronic ferritin release and neurotoxicity.	neurotoxicity→ThemeOf→lead Irregularities→ThemeOf→regulation neurotoxicity→ThemeOf→regulation neurotoxicity→ThemeOf→Irregularities regulation→ThemeOf→chronic ferritin release regulation→ThemeOf→lead chronic ferritin release→ThemeOf→lead regulation→ThemeOf→neurotoxicity chronic ferritin release→ThemeOf→neurotoxicity regulation→ThemeOf→Irregularities chronic ferritin release→ThemeOf→regulation Irregularities→ThemeOf→chronic ferritin release chronic ferritin release→ThemeOf→Irregularities Irregularities→CauseOf→lead neurotoxicity→ThemeOf→chronic ferritin release Irregularities→ThemeOf→neurotoxicity
345	35052575	7164	However, recent studies highlight that heavy metal exposure alters both the native gut microbiota and intestinal physiology.	heavy metal→CauseOf→alters heavy metal→ThemeOf→gut gut→ThemeOf→heavy metal gut→ThemeOf→alters
346	35052575	7165	Specifically, additional damage due to heavy metals disruption of the gut epithelium leads to a heightened inflammatory response, thus disrupting GI tight junctions and promoting systemic inflammation by inciting changes in microbial abundance and microbial-mediated metabolic changes.	inflammation→ThemeOf→promoting disruption→ThemeOf→age promoting→CauseOf→heightened inflammatory response→ThemeOf→gut gut→ThemeOf→disruption inflammation→ThemeOf→heightened disruption→ThemeOf→gut heightened→CauseOf→disrupting age→ThemeOf→disrupting gut→ThemeOf→heavy metals disruption inflammation→ThemeOf→inflammatory response heavy metals disruption→CauseOf→disrupting heightened→CauseOf→promoting age→ThemeOf→inflammation gut→ThemeOf→promoting inflammation→ThemeOf→age heavy metals disruption→ThemeOf→inflammation inflammatory response→ThemeOf→disrupting age→ThemeOf→disruption gut→ThemeOf→heightened inflammation→ThemeOf→gut heavy metals disruption→CauseOf→promoting inflammatory response→ThemeOf→inflammation age→ThemeOf→heavy metals disruption gut→ThemeOf→inflammatory response disrupting→CauseOf→promoting disruption→CauseOf→disrupting heavy metals disruption→CauseOf→heightened inflammatory response→ThemeOf→disruption age→ThemeOf→promoting disrupting→CauseOf→heightened disruption→ThemeOf→inflammation heavy metals disruption→ThemeOf→inflammatory response inflammatory response→ThemeOf→heavy metals disruption age→ThemeOf→heightened inflammation→ThemeOf→disrupting disruption→CauseOf→promoting heavy metals disruption→ThemeOf→age inflammatory response→ThemeOf→promoting age→ThemeOf→inflammatory response inflammation→ThemeOf→disruption disruption→CauseOf→heightened heavy metals disruption→ThemeOf→gut inflammatory response→ThemeOf→heightened gut→ThemeOf→disrupting inflammation→ThemeOf→heavy metals disruption disruption→ThemeOf→inflammatory response promoting→CauseOf→disrupting inflammatory response→ThemeOf→age gut→ThemeOf→inflammation
347	35052575	7208	Most recently, berberine supplementation was reported to increase dopamine levels in the brains of mice with PD by modulating the gut microbiota, such as Enterococcus spp..	gut→ThemeOf→increase gut→ThemeOf→dopamine levels gut→ThemeOf→modulating gut→ThemeOf→berberine modulating→CauseOf→increase increase→CauseOf→modulating berberine→CauseOf→increase dopamine levels→ThemeOf→increase berberine→ThemeOf→dopamine levels dopamine levels→ThemeOf→gut berberine→ThemeOf→gut dopamine levels→ThemeOf→modulating berberine→CauseOf→modulating dopamine levels→ThemeOf→berberine
348	35052575	7235	For example, human colorectal cells with DMT1 expression knocked-down have a decreased uptake of Fe2+, Pb2+, and Cd2+.	knocked-down→CauseOf→decreased
349	35052575	7236	Organic anion transporters that are involved in intestinal uptake of CH3Hg+ through Zinc carriers (ZIP8 and ZIP14) interact with both Hg2+ and Mn2+.	CH3Hg+→CauseOf→involved ZIP8→ThemeOf→CH3Hg+ ZIP8→ThemeOf→involved ZIP14→ThemeOf→CH3Hg+ ZIP14→ThemeOf→involved CH3Hg+→ThemeOf→ZIP14 CH3Hg+→ThemeOf→ZIP8
350	35052575	7258	While the uptake mechanisms are not clear, dietary Fe may influence Mn transport through non-competitive mechanisms.	dietary→CauseOf→influence
351	35052575	7261	LAT-1 is located in endothelial and pericyte cell membranes and recruits MeHg into the brain; the shuttling of MeHg into the brain further induces the dysfunction of astrocytes and pericytes by increasing BBB permeability.	shuttling→ThemeOf→dysfunction LAT-1→CauseOf→MeHg dysfunction→ThemeOf→increasing shuttling→CauseOf→induces LAT-1→ThemeOf→dysfunction induces→CauseOf→increasing shuttling→ThemeOf→BBB permeability LAT-1→ThemeOf→induces BBB permeability→ThemeOf→shuttling shuttling→CauseOf→increasing LAT-1→ThemeOf→BBB permeability BBB permeability→CauseOf→MeHg MeHg→CauseOf→LAT-1 LAT-1→ThemeOf→increasing BBB permeability→ThemeOf→LAT-1 MeHg→CauseOf→dysfunction dysfunction→ThemeOf→shuttling BBB permeability→ThemeOf→dysfunction MeHg→CauseOf→induces dysfunction→CauseOf→MeHg BBB permeability→ThemeOf→induces MeHg→CauseOf→BBB permeability dysfunction→ThemeOf→LAT-1 BBB permeability→ThemeOf→increasing MeHg→CauseOf→increasing dysfunction→ThemeOf→induces increasing→CauseOf→induces shuttling→ThemeOf→LAT-1 LAT-1→ThemeOf→shuttling dysfunction→ThemeOf→BBB permeability
352	35052575	7262	Specifically, MeHg exposure inhibits aquaporin AQP4 in astrocytes, leading to alterations in water balance and, consequently, contributing to neurodegeneration.	leading→CauseOf→inhibits alterations→CauseOf→contributing AQP4→ThemeOf→leading leading→CauseOf→contributing neurodegeneration→ThemeOf→leading AQP4→ThemeOf→MeHg MeHg→CauseOf→leading neurodegeneration→ThemeOf→MeHg AQP4→ThemeOf→alterations MeHg→CauseOf→alterations neurodegeneration→ThemeOf→alterations AQP4→ThemeOf→neurodegeneration MeHg→ThemeOf→neurodegeneration neurodegeneration→ThemeOf→inhibits AQP4→ThemeOf→inhibits MeHg→CauseOf→inhibits neurodegeneration→ThemeOf→AQP4 AQP4→ThemeOf→contributing MeHg→ThemeOf→AQP4 neurodegeneration→ThemeOf→contributing contributing→CauseOf→leading MeHg→CauseOf→contributing inhibits→CauseOf→leading contributing→CauseOf→alterations alterations→CauseOf→leading inhibits→CauseOf→alterations contributing→CauseOf→inhibits leading→CauseOf→alterations alterations→CauseOf→inhibits inhibits→CauseOf→contributing
353	35052575	7267	Alterations in tight-junction proteins such as ZO-1 translate to uncontrollable Cd uptake in the brain, which in turn induces the impairment of neural tissue functioning.	uncontrollable→ThemeOf→Alterations Alterations→CauseOf→induces uncontrollable→ThemeOf→ZO-1 ZO-1→ThemeOf→uncontrollable uncontrollable→ThemeOf→induces ZO-1→ThemeOf→neural tissue functioning neural tissue functioning→ThemeOf→uncontrollable ZO-1→ThemeOf→Alterations neural tissue functioning→ThemeOf→Alterations ZO-1→ThemeOf→induces neural tissue functioning→ThemeOf→ZO-1 neural tissue functioning→ThemeOf→induces Alterations→ThemeOf→uncontrollable Alterations→ThemeOf→neural tissue functioning uncontrollable→ThemeOf→neural tissue functioning Alterations→ThemeOf→ZO-1
354	35052575	7270	Metal stress upon the hippocampus is linked to accelerated aging, memory loss, and dementia.	Metal stress→CauseOf→linked dementia→ThemeOf→memory loss dementia→ThemeOf→Metal stress dementia→ThemeOf→linked memory loss→ThemeOf→Metal stress memory loss→ThemeOf→dementia memory loss→ThemeOf→linked Metal stress→ThemeOf→memory loss Metal stress→ThemeOf→dementia
355	35052575	7280	Oxidative stress disrupts gut and BBB barriers, leading to alpha-synuclein misfolding, aggregation, and subsequent neuronal damage in both ENS and CNS.	gut→ThemeOf→disrupts alpha-synuclein→ThemeOf→leading to aggregation→ThemeOf→gut alpha-synuclein→ThemeOf→disrupts leading to→CauseOf→disrupts aggregation→ThemeOf→alpha-synuclein disrupts→CauseOf→leading to misfolding→ThemeOf→gut gut→ThemeOf→misfolding misfolding→ThemeOf→alpha-synuclein gut→ThemeOf→aggregation alpha-synuclein→ThemeOf→misfolding misfolding→CauseOf→leading to alpha-synuclein→ThemeOf→aggregation misfolding→CauseOf→disrupts gut→ThemeOf→leading to
356	35052575	7287	Alterations in microbiota stimulate ROS production by activating the cytoplasmic NLRP3-associated inflammasome, regulating the maturation and secretion of pro-inflammatory cytokines, such as IL-1beta in epithelial cells, thereby promoting Th17 cell differentiation.	microbiota→ThemeOf→promoting activating→CauseOf→regulating promoting→CauseOf→stimulate Alterations→ThemeOf→Th1 ROS production→ThemeOf→maturation maturation→ThemeOf→Alterations Th1→ThemeOf→Alterations NLRP3→ThemeOf→ROS production secretion→ThemeOf→IL-1beta microbiota→ThemeOf→Alterations IL-1beta→ThemeOf→stimulate promoting→CauseOf→activating Alterations→ThemeOf→NLRP3 ROS production→ThemeOf→Th1 maturation→ThemeOf→ROS production Th1→ThemeOf→ROS production NLRP3→ThemeOf→maturation secretion→ThemeOf→promoting microbiota→ThemeOf→ROS production IL-1beta→ThemeOf→microbiota promoting→CauseOf→regulating Alterations→CauseOf→regulating ROS production→ThemeOf→NLRP3 maturation→ThemeOf→Th1 Th1→ThemeOf→maturation NLRP3→ThemeOf→regulating secretion→ThemeOf→Alterations microbiota→ThemeOf→maturation IL-1beta→ThemeOf→activating Alterations→CauseOf→stimulate Alterations→ThemeOf→secretion ROS production→ThemeOf→regulating maturation→ThemeOf→NLRP3 Th1→ThemeOf→regulating NLRP3→ThemeOf→secretion secretion→ThemeOf→ROS production stimulate→CauseOf→activating microbiota→ThemeOf→Th1 IL-1beta→ThemeOf→promoting Alterations→ThemeOf→microbiota ROS production→ThemeOf→stimulate ROS production→ThemeOf→secretion maturation→ThemeOf→regulating Th1→ThemeOf→secretion regulating→CauseOf→stimulate secretion→ThemeOf→maturation stimulate→CauseOf→promoting microbiota→ThemeOf→NLRP3 IL-1beta→ThemeOf→Alterations Alterations→CauseOf→activating ROS production→ThemeOf→microbiota maturation→ThemeOf→stimulate maturation→ThemeOf→secretion NLRP3→ThemeOf→stimulate regulating→CauseOf→activating secretion→ThemeOf→Th1 stimulate→CauseOf→regulating microbiota→ThemeOf→regulating IL-1beta→ThemeOf→ROS production Alterations→ThemeOf→IL-1beta ROS production→ThemeOf→activating maturation→ThemeOf→microbiota Th1→ThemeOf→stimulate NLRP3→ThemeOf→microbiota regulating→CauseOf→promoting secretion→ThemeOf→NLRP3 microbiota→ThemeOf→stimulate microbiota→ThemeOf→secretion IL-1beta→ThemeOf→maturation Alterations→CauseOf→promoting ROS production→ThemeOf→IL-1beta maturation→ThemeOf→activating Th1→ThemeOf→microbiota NLRP3→ThemeOf→activating secretion→ThemeOf→stimulate secretion→ThemeOf→regulating microbiota→ThemeOf→activating activating→CauseOf→stimulate IL-1beta→ThemeOf→regulating Alterations→ThemeOf→ROS production ROS production→ThemeOf→promoting maturation→ThemeOf→IL-1beta Th1→ThemeOf→activating NLRP3→ThemeOf→promoting secretion→ThemeOf→microbiota microbiota→ThemeOf→IL-1beta activating→CauseOf→promoting IL-1beta→ThemeOf→secretion Alterations→ThemeOf→maturation ROS production→ThemeOf→Alterations maturation→ThemeOf→promoting Th1→ThemeOf→promoting NLRP3→ThemeOf→Alterations secretion→ThemeOf→activating
357	35052575	7290	The changes in the microbiome are related to beneficial effects, such as rebalancing in gut microbial communities, and the attenuation of inflammation, all highlight that modulation of the gut microbiota via inflammasome signaling likely alters brain functioning.	modulation→ThemeOf→gut modulation→CauseOf→alters gut→ThemeOf→brain functioning rebalancing→ThemeOf→gut brain functioning→ThemeOf→gut gut→ThemeOf→modulation modulation→ThemeOf→gut gut→ThemeOf→alters gut→ThemeOf→brain functioning modulation→ThemeOf→rebalancing gut→ThemeOf→inflammation gut→ThemeOf→modulation gut→ThemeOf→rebalancing gut→ThemeOf→alters inflammation→ThemeOf→gut gut→ThemeOf→inflammation rebalancing→ThemeOf→gut brain functioning→ThemeOf→gut gut→ThemeOf→rebalancing rebalancing→ThemeOf→modulation inflammation→ThemeOf→gut rebalancing→ThemeOf→alters
358	35052575	7302	Mitochondrial oxidative stress further exacerbates ROS production and drives neuroinflammation in the brain by perturbing muscarinic and dopaminergic receptors.	ROS production→ThemeOf→perturbing Mitochondrial→CauseOf→exacerbates ROS production→ThemeOf→Mitochondrial Mitochondrial→CauseOf→drives inflammation→ThemeOf→ROS production exacerbates→CauseOf→drives Mitochondrial→CauseOf→perturbing inflammation→ThemeOf→exacerbates exacerbates→CauseOf→perturbing inflammation→ThemeOf→drives drives→CauseOf→exacerbates inflammation→ThemeOf→perturbing drives→CauseOf→perturbing inflammation→ThemeOf→Mitochondrial perturbing→CauseOf→exacerbates ROS production→ThemeOf→inflammation perturbing→CauseOf→drives ROS production→ThemeOf→exacerbates Mitochondrial→ThemeOf→inflammation ROS production→ThemeOf→drives Mitochondrial→ThemeOf→ROS production
359	35052575	7303	Furthermore, the Mn3+ oxidation of dopamine increases the relative concentration of localized, oxidized dopamine, resulting in increased oxidative stress.	Mn3+ oxidation→CauseOf→increases Mn3+ oxidation→CauseOf→increased dopamine→ThemeOf→Mn3+ oxidation dopamine→ThemeOf→increases dopamine→ThemeOf→increased Mn3+ oxidation→ThemeOf→dopamine increases→CauseOf→increased increased→CauseOf→increases
360	35052575	7307	For example, MeHg causes apoptosis within 18 h of exposure by impairing mitochondrial mRNA expression, inciting the mutation of mtDNA, and leading to the excessive production of ROS.	excessive→CauseOf→leading to mtDNA→ThemeOf→mutation mutation→ThemeOf→mitochondrial mRNA mitochondrial mRNA→ThemeOf→MeHg MeHg→ThemeOf→mtDNA production of ROS→ThemeOf→excessive excessive→CauseOf→inciting mtDNA→ThemeOf→mitochondrial mRNA mutation→CauseOf→inciting mitochondrial mRNA→ThemeOf→impairing MeHg→ThemeOf→mitochondrial mRNA production of ROS→ThemeOf→leading to excessive→CauseOf→impairing mtDNA→ThemeOf→inciting mutation→CauseOf→impairing mitochondrial mRNA→ThemeOf→production of ROS MeHg→CauseOf→inciting production of ROS→ThemeOf→mtDNA leading to→CauseOf→causes mtDNA→ThemeOf→MeHg mutation→ThemeOf→production of ROS inciting→CauseOf→causes MeHg→CauseOf→impairing production of ROS→ThemeOf→mutation leading to→CauseOf→excessive mtDNA→ThemeOf→impairing mitochondrial mRNA→ThemeOf→causes inciting→CauseOf→excessive MeHg→ThemeOf→production of ROS production of ROS→ThemeOf→mitochondrial mRNA causes→CauseOf→excessive leading to→CauseOf→inciting mtDNA→ThemeOf→production of ROS mitochondrial mRNA→ThemeOf→excessive inciting→CauseOf→leading to impairing→CauseOf→causes production of ROS→ThemeOf→inciting causes→CauseOf→leading to leading to→CauseOf→impairing mutation→CauseOf→causes mitochondrial mRNA→ThemeOf→leading to inciting→CauseOf→impairing impairing→CauseOf→excessive production of ROS→ThemeOf→MeHg causes→CauseOf→inciting mtDNA→ThemeOf→causes mutation→CauseOf→excessive mitochondrial mRNA→ThemeOf→mtDNA MeHg→CauseOf→causes impairing→CauseOf→leading to production of ROS→ThemeOf→impairing causes→CauseOf→impairing mtDNA→ThemeOf→excessive mutation→CauseOf→leading to mitochondrial mRNA→ThemeOf→mutation MeHg→CauseOf→excessive impairing→CauseOf→inciting excessive→CauseOf→causes mtDNA→ThemeOf→leading to mutation→ThemeOf→mtDNA mitochondrial mRNA→ThemeOf→inciting MeHg→CauseOf→leading to production of ROS→ThemeOf→causes
361	35052575	7367	The neurotoxic effects include effects in the dopaminergic function in the striatal zone on the brain, where high rates of both oxygen consumption and metabolic rates are crucial factors for increasing brain sensitivity to oxidative damage.. Additionally, alterations in GABA receptor expression are related to anxiety and depression symptoms, which occur in tandem with IBD.	GABA receptor→ThemeOf→alterations neurotoxic→ThemeOf→age GABA receptor→ThemeOf→related expression→ThemeOf→GABA receptor IBD→ThemeOf→age age→ThemeOf→expression age→ThemeOf→IBD expression→ThemeOf→age alterations→ThemeOf→GABA receptor depression symptoms→ThemeOf→age age→ThemeOf→neurotoxic alterations→CauseOf→related GABA receptor→ThemeOf→expression age→ThemeOf→anxiety alterations→ThemeOf→age age→ThemeOf→alterations age→ThemeOf→depression symptoms anxiety→ThemeOf→age age→ThemeOf→related
362	35052575	7393	An important example of these transformations is the methylation of heavy metals, which increases their solubility, and thus the potential transport to the brain.	methylation→CauseOf→increases
363	35052575	7403	Although metals are biologically important, they are usually required in trace amounts, excessive metal accumulation in various organs induces various detrimental intracellular events (oxidative stress, mitochondrial dysfunction, DNA fragmentation, protein misfolding, endoplasmic reticulum (ER) stress, autophagy dysregulation, and the activation of apoptosis).	mitochondrial dysfunction→ThemeOf→autophagy dysregulation DNA fragmentation→ThemeOf→mitochondrial dysfunction detrimental intracellular events→ThemeOf→metal autophagy dysregulation→ThemeOf→activation mitochondrial dysfunction→ThemeOf→induces DNA fragmentation→ThemeOf→protein detrimental intracellular events→ThemeOf→autophagy dysregulation autophagy dysregulation→ThemeOf→mitochondrial dysfunction protein→ThemeOf→activation DNA fragmentation→ThemeOf→detrimental intracellular events detrimental intracellular events→ThemeOf→induces autophagy dysregulation→ThemeOf→protein protein→ThemeOf→mitochondrial dysfunction DNA fragmentation→ThemeOf→metal metal→CauseOf→activation autophagy dysregulation→ThemeOf→DNA fragmentation activation→ThemeOf→induces protein→ThemeOf→DNA fragmentation DNA fragmentation→ThemeOf→autophagy dysregulation metal→ThemeOf→mitochondrial dysfunction autophagy dysregulation→ThemeOf→detrimental intracellular events mitochondrial dysfunction→ThemeOf→activation protein→ThemeOf→detrimental intracellular events DNA fragmentation→ThemeOf→induces metal→ThemeOf→protein autophagy dysregulation→ThemeOf→metal mitochondrial dysfunction→ThemeOf→protein protein→ThemeOf→metal detrimental intracellular events→ThemeOf→activation metal→ThemeOf→DNA fragmentation autophagy dysregulation→ThemeOf→induces mitochondrial dysfunction→ThemeOf→DNA fragmentation protein→ThemeOf→autophagy dysregulation detrimental intracellular events→ThemeOf→mitochondrial dysfunction metal→ThemeOf→detrimental intracellular events induces→ThemeOf→activation mitochondrial dysfunction→ThemeOf→detrimental intracellular events protein→ThemeOf→induces detrimental intracellular events→ThemeOf→protein metal→ThemeOf→autophagy dysregulation mitochondrial dysfunction→ThemeOf→metal DNA fragmentation→ThemeOf→activation detrimental intracellular events→ThemeOf→DNA fragmentation metal→CauseOf→induces
364	35053920	7426	NSLAB significantly contribute to cheese flavor, texture, nutritional value, and microbial safety in most of the ripened cheese varieties; however, some cheese quality defects and off-flavors, especially in the later phases of ripening, have been attributed to NSLAB.	NSLAB→CauseOf→contribute cheese flavor→CauseOf→NSLAB cheese quality defects→CauseOf→NSLAB NSLAB→CauseOf→cheese quality defects microbial→CauseOf→NSLAB NSLAB→CauseOf→microbial NSLAB→CauseOf→cheese flavor NSLAB→CauseOf→contribute microbial→CauseOf→NSLAB NSLAB→CauseOf→cheese quality defects cheese quality defects→CauseOf→NSLAB cheese flavor→CauseOf→NSLAB NSLAB→CauseOf→microbial NSLAB→CauseOf→cheese flavor
365	35053920	7497	Residual lactose in the curd is rapidly depleted, mainly by NSLAB, during the early stages of ripening.	NSLAB→CauseOf→depleted NSLAB→ThemeOf→Residual lactose Residual lactose→ThemeOf→depleted Residual lactose→ThemeOf→NSLAB
366	35053920	7508	Citrate, although present at relatively low concentrations in milk (approximately 10 mM), can have a profound impact on cheese aroma.	Citrate→ThemeOf→aroma Citrate→CauseOf→impact aroma→ThemeOf→Citrate aroma→ThemeOf→impact
367	35053920	7512	Although carbon dioxide is responsible for cavity formation in certain cheese types, regarding flavor development, the co-metabolism of citrate and lactose leads to characteristic C4 aroma compounds, such as diacetyl, acetoin, and 2,3-butanediol.	citrate→ThemeOf→diacetyl citrate→ThemeOf→C4 aroma acetoin→ThemeOf→citrate citrate→ThemeOf→acetoin acetoin→ThemeOf→leads to diacetyl→ThemeOf→citrate acetoin→ThemeOf→diacetyl diacetyl→ThemeOf→leads to diacetyl→ThemeOf→acetoin C4 aroma→ThemeOf→citrate C4 aroma→ThemeOf→leads to citrate→CauseOf→leads to
368	35053920	7527	Additionally, esterification of hydroxy-fatty acids produces lactones that also contribute to cheese flavor (Figure 4).	esterification→ThemeOf→cheese flavor cheese flavor→ThemeOf→lactones cheese flavor→ThemeOf→esterification cheese flavor→ThemeOf→contribute lactones→ThemeOf→esterification lactones→ThemeOf→contribute lactones→ThemeOf→cheese flavor esterification→ThemeOf→lactones esterification→CauseOf→contribute
369	35071941	6643	also reported that Tetragenococcus, Halanaerobium and Lactobacillus were the dominant bacteria in pla-ra from Northeastern Thailand, while Thakur et al., Lindayani et al.	Tetragenococcus→ThemeOf→Lindayani Lactobacillus→ThemeOf→Lindayani Lindayani→ThemeOf→Tetragenococcus Lindayani→ThemeOf→Lactobacillus
370	35071941	6672	who noted that E. faecium EM485 and E. faecium EM 925 had surface hydrophobicity values of 8.18% and 11.33% in the presence of n-hexadecane, respectively.	EM485→ThemeOf→surface hydrophobicity surface hydrophobicity→ThemeOf→EM485
371	35130830	7829	Further, the Bray-Curtis dissimilarity was lower for the 16S copy number correction (black circles) compared to the raw data (gray circles) in most samples; only in samples S04, S06, S08, and S18 was the Bray-Curtis dissimilarity higher.	S18→ThemeOf→S04 Bray-Curtis dissimilarity→ThemeOf→lower S06→ThemeOf→Bray-Curtis dissimilarity S18→ThemeOf→Bray-Curtis dissimilarity Bray-Curtis dissimilarity→ThemeOf→S08 S06→CauseOf→lower S18→ThemeOf→Bray-Curtis dissimilarity Bray-Curtis dissimilarity→ThemeOf→S04 S08→ThemeOf→S18 S18→ThemeOf→S06 Bray-Curtis dissimilarity→ThemeOf→S18 S08→ThemeOf→Bray-Curtis dissimilarity S18→ThemeOf→lower Bray-Curtis dissimilarity→ThemeOf→Bray-Curtis dissimilarity S08→ThemeOf→Bray-Curtis dissimilarity S18→ThemeOf→S08 Bray-Curtis dissimilarity→ThemeOf→S06 S08→CauseOf→lower S04→ThemeOf→S18 Bray-Curtis dissimilarity→ThemeOf→S04 Bray-Curtis dissimilarity→ThemeOf→lower S04→ThemeOf→Bray-Curtis dissimilarity Bray-Curtis dissimilarity→ThemeOf→S18 Bray-Curtis dissimilarity→ThemeOf→S08 S04→ThemeOf→Bray-Curtis dissimilarity Bray-Curtis dissimilarity→ThemeOf→Bray-Curtis dissimilarity S06→ThemeOf→S18 S04→CauseOf→lower Bray-Curtis dissimilarity→ThemeOf→S06 S06→ThemeOf→Bray-Curtis dissimilarity
372	35130830	7836	The 16S rRNA GCN had only a major influence on the bias for species with a high average number of copies, namely L. delbrueckii (avg.	L. delbrueckii→ThemeOf→bias bias→ThemeOf→L. delbrueckii
373	35204173	7849	Sprague-Dawley rats were orally administered Bacillus SC06 or SC08 for a 24-day period and thereafter intraperitoneally injected diquat (DQ) to induce oxidative stress.	SC06→ThemeOf→SC08 SC08→ThemeOf→SC06
374	35204173	7850	Results showed that Bacillus, particularly SC06 significantly inhibited hepatic injuries, as evidenced by the alleviated damaged liver structure, the decreased levels of ALT, AST, ALP and LDH, and the suppressed mitochondrial dysfunction.	SC06→ThemeOf→mitochondrial dysfunction mitochondrial dysfunction→ThemeOf→inhibited hepatic injuries→ThemeOf→ALP levels of ALT→ThemeOf→SC06 ALP→ThemeOf→decreased SC06→ThemeOf→hepatic injuries mitochondrial dysfunction→ThemeOf→damaged liver decreased→CauseOf→inhibited levels of ALT→ThemeOf→mitochondrial dysfunction ALP→ThemeOf→inhibited SC06→CauseOf→decreased mitochondrial dysfunction→ThemeOf→levels of ALT inhibited→CauseOf→decreased levels of ALT→ThemeOf→hepatic injuries ALP→ThemeOf→damaged liver SC06→CauseOf→inhibited mitochondrial dysfunction→ThemeOf→ALP damaged liver→ThemeOf→SC06 levels of ALT→ThemeOf→decreased ALP→ThemeOf→levels of ALT SC06→ThemeOf→damaged liver hepatic injuries→ThemeOf→SC06 damaged liver→ThemeOf→mitochondrial dysfunction levels of ALT→ThemeOf→inhibited SC06→ThemeOf→levels of ALT hepatic injuries→ThemeOf→mitochondrial dysfunction damaged liver→ThemeOf→hepatic injuries levels of ALT→ThemeOf→damaged liver SC06→ThemeOf→ALP hepatic injuries→ThemeOf→decreased damaged liver→ThemeOf→decreased levels of ALT→ThemeOf→ALP mitochondrial dysfunction→ThemeOf→SC06 hepatic injuries→ThemeOf→inhibited damaged liver→ThemeOf→inhibited ALP→ThemeOf→SC06 mitochondrial dysfunction→ThemeOf→hepatic injuries hepatic injuries→ThemeOf→damaged liver damaged liver→ThemeOf→levels of ALT ALP→ThemeOf→mitochondrial dysfunction mitochondrial dysfunction→ThemeOf→decreased hepatic injuries→ThemeOf→levels of ALT damaged liver→ThemeOf→ALP ALP→ThemeOf→hepatic injuries
375	35204173	7853	The microbial metagenomic analysis demonstrated that Bacillus, particularly SC06 markedly suppress the metabolic pathways such as carbohydrate metabolism, lipid metabolism, amino acid metabolism and metabolism of cofactors and vitamins.	SC06→CauseOf→suppress
376	35204173	7854	Furthermore, SC06 decreased the gene abundance of the pathways mediating bacterial replication, secretion and pathogenicity.	SC06→CauseOf→decreased
377	35204173	7862	It has been reported that in stellate cells, ROS- induced lipid peroxidation activates the inflammation and fibrogenesis, and ultimately causes liver fat accumulation.	liver fat accumulation→ThemeOf→fibrogenesis causes→CauseOf→activates inflammation→ThemeOf→ROS- liver fat accumulation→ThemeOf→causes ROS-→ThemeOf→liver fat accumulation liver fat accumulation→ThemeOf→ROS- ROS-→CauseOf→activates liver fat accumulation→ThemeOf→inflammation ROS-→ThemeOf→fibrogenesis activates→CauseOf→causes ROS-→CauseOf→causes fibrogenesis→ThemeOf→liver fat accumulation ROS-→ThemeOf→inflammation fibrogenesis→ThemeOf→activates inflammation→ThemeOf→liver fat accumulation fibrogenesis→ThemeOf→causes inflammation→ThemeOf→activates fibrogenesis→ThemeOf→ROS- inflammation→ThemeOf→fibrogenesis liver fat accumulation→ThemeOf→activates fibrogenesis→ThemeOf→inflammation inflammation→ThemeOf→causes
378	35204173	7863	Furthermore, ROS generation promotes hepatic insulin resistance, necro-inflammation and finally leads to hepatocyte apoptosis.	necro-inflammation→ThemeOf→promotes hepatic insulin→ThemeOf→necro-inflammation leads→CauseOf→promotes necro-inflammation→ThemeOf→hepatic insulin hepatic insulin→ThemeOf→hepatocyte ROS→CauseOf→leads hepatocyte→ThemeOf→leads hepatic insulin→ThemeOf→promotes ROS→ThemeOf→necro-inflammation hepatocyte→ThemeOf→ROS ROS→ThemeOf→hepatocyte hepatocyte→ThemeOf→necro-inflammation ROS→CauseOf→promotes hepatocyte→ThemeOf→promotes ROS→ThemeOf→hepatic insulin hepatocyte→ThemeOf→hepatic insulin necro-inflammation→ThemeOf→leads promotes→CauseOf→leads necro-inflammation→ThemeOf→ROS hepatic insulin→ThemeOf→leads necro-inflammation→ThemeOf→hepatocyte hepatic insulin→ThemeOf→ROS
379	35204173	7874	Although alteration of gut microbiota has been reported to be a useful integrative treatment of chronic liver diseases, few studies have explored the protective effect of probiotics on oxidative stress-induced liver injuries and the underlying mechanisms remain unknown.	alteration→ThemeOf→liver diseases alteration→ThemeOf→gut microbiota gut microbiota→ThemeOf→liver injuries liver injuries→ThemeOf→liver diseases gut microbiota→ThemeOf→liver diseases liver injuries→ThemeOf→alteration gut microbiota→ThemeOf→alteration liver injuries→ThemeOf→gut microbiota liver diseases→ThemeOf→liver injuries liver diseases→ThemeOf→alteration liver diseases→ThemeOf→gut microbiota alteration→ThemeOf→liver injuries
380	35204173	7875	Our previous results showed that Bacillus amyloliquefaciens SC06 and Bacillus licheniformis SC08 could alleviate oxidative stress-induced intestinal disorders and apoptosis.	apoptosis→ThemeOf→SC08 apoptosis→ThemeOf→alleviate intestinal disorders→ThemeOf→SC06 intestinal disorders→ThemeOf→apoptosis intestinal disorders→ThemeOf→SC08 SC06→ThemeOf→apoptosis intestinal disorders→ThemeOf→alleviate SC06→ThemeOf→intestinal disorders SC08→ThemeOf→apoptosis SC06→CauseOf→alleviate SC08→ThemeOf→intestinal disorders apoptosis→ThemeOf→SC06 SC08→CauseOf→alleviate apoptosis→ThemeOf→intestinal disorders
381	35204173	7906	However, SC06 decreased the tissue damages and reversed to the normal histological structure (Figure 1A).	decreased→CauseOf→reversed SC06→CauseOf→reversed SC06→CauseOf→decreased reversed→CauseOf→decreased
382	35204173	7908	SC06 administration significantly lowered the increased LDH level caused by DQ exposure.	DQ exposure→ThemeOf→SC06 LDH level→ThemeOf→SC06 DQ exposure→ThemeOf→LDH level increased→CauseOf→lowered SC06→CauseOf→lowered SC06→ThemeOf→DQ exposure SC06→CauseOf→increased SC06→ThemeOf→LDH level lowered→CauseOf→increased LDH level→ThemeOf→lowered DQ exposure→ThemeOf→lowered LDH level→ThemeOf→DQ exposure DQ exposure→ThemeOf→increased LDH level→ThemeOf→increased
383	35204173	7913	SC06 pretreatment could also significantly decreased ROS production (Figure 2B).	SC06→CauseOf→decreased SC06→ThemeOf→ROS production ROS production→ThemeOf→SC06 ROS production→ThemeOf→decreased
384	35204173	7915	As shown in Figure 2C, a dramatic DeltaPsim reduction was found in DQ-treated rats (p < 0.01) but was reversed by SC06 pretreatment (p < 0.05).	DeltaPsim reduction→ThemeOf→DQ-treated DQ-treated→ThemeOf→DeltaPsim reduction
385	35204173	7918	As displayed in Figure 3A, SC06 pretreatment markedly decreased MDA level induced by DQ exposure.	SC06→CauseOf→decreased
386	35204173	7920	Only SC06 pretreatment increased SOD activity.	SC06→CauseOf→increased
387	35204173	7923	Furthermore, SC06 markedly down-regulated the increased expression of NADPH oxidase subunit p47.	SC06→CauseOf→increased SC06→CauseOf→down-regulated SC06→ThemeOf→NADPH down-regulated→CauseOf→increased increased→CauseOf→down-regulated NADPH→ThemeOf→increased expression→ThemeOf→increased NADPH→ThemeOf→expression NADPH→ThemeOf→SC06 NADPH→ThemeOf→down-regulated expression→ThemeOf→NADPH
388	35204173	7925	As shown in the PCoA scatterplot, DQ treatment caused a visible shift from the other groups (Figure 4B).	visible shift→ThemeOf→DQ treatment DQ treatment→CauseOf→caused DQ treatment→ThemeOf→visible shift visible shift→ThemeOf→caused
389	35204173	7930	The f_Bacteroidaceae, g_Bacteroides, s_Blautiaproducta and s_Alistipesindistinctus showed large effect sizes in SC08 + DQ group.	g_Bacteroides→ThemeOf→s_Alistipesindistinctus s_Alistipesindistinctus→ThemeOf→f_Bacteroidaceae s_Alistipesindistinctus→ThemeOf→g_Bacteroides f_Bacteroidaceae→ThemeOf→s_Alistipesindistinctus
390	35204173	7932	Compared to the DQ group, SC06 pretreatment significantly upregulated the levels of g_Anaerofilum and s_Bacteroides uniformis, and downregulated s_Oscillospira guilliermondil (p < 0.05).	s_Bacteroides→ThemeOf→SC06 s_Oscillospira→ThemeOf→downregulated s_Bacteroides→ThemeOf→downregulated s_Oscillospira→ThemeOf→upregulated s_Bacteroides→ThemeOf→upregulated s_Oscillospira→ThemeOf→levels of g_Anaerofilum and SC06→CauseOf→downregulated s_Bacteroides→ThemeOf→levels of g_Anaerofilum and SC06→CauseOf→upregulated levels of g_Anaerofilum and→ThemeOf→SC06 SC06→ThemeOf→s_Bacteroides levels of g_Anaerofilum and→ThemeOf→downregulated SC06→ThemeOf→levels of g_Anaerofilum and levels of g_Anaerofilum and→ThemeOf→upregulated SC06→ThemeOf→s_Oscillospira levels of g_Anaerofilum and→ThemeOf→s_Bacteroides downregulated→CauseOf→upregulated levels of g_Anaerofilum and→ThemeOf→s_Oscillospira upregulated→CauseOf→downregulated s_Oscillospira→ThemeOf→SC06
391	35204173	7933	SC08 pretreatment markedly increased the richness of g_Helicobacter (p < 0.05).	richness→ThemeOf→g_Helicobacter richness→ThemeOf→increased SC08→ThemeOf→g_Helicobacter SC08→ThemeOf→richness SC08→CauseOf→increased g_Helicobacter→ThemeOf→SC08 g_Helicobacter→ThemeOf→richness g_Helicobacter→ThemeOf→increased richness→ThemeOf→SC08
392	35204173	7943	At the first level of KEGG pathways, DQ exposure showed a marked increase in the function of gut microbial metabolism while Bacillus pretreatments, particularly SC06 down-regulated the increased trend (data not shown).	increase→CauseOf→down-regulated down-regulated→CauseOf→increase SC06→ThemeOf→function gut microbial metabolism→ThemeOf→SC06 SC06→CauseOf→increase gut microbial metabolism→ThemeOf→function SC06→CauseOf→down-regulated gut microbial metabolism→ThemeOf→increase SC06→ThemeOf→gut microbial metabolism gut microbial metabolism→ThemeOf→down-regulated function→ThemeOf→SC06 function→ThemeOf→increase function→ThemeOf→down-regulated function→ThemeOf→gut microbial metabolism
393	35204173	7944	Results from the KEGG second level involving metabolism showed that DQ exposure activated all the metabolic pathways, whereas Bacillus administrations could reverse this trend.	DQ exposure→CauseOf→activated
394	35204173	7950	Specifically, SC06 dramatically reduced the genes involving in Lysine degradation, Tyrosine metabolism, Phenylalanine metabolism, Tryptophan metabolism and D-alanine metabolism (p < 0.01).	Lysine degradation→ThemeOf→reduced Tryptophan metabolism→ThemeOf→SC06 Tyrosine metabolism→ThemeOf→Phenylalanine metabolism Phenylalanine metabolism→ThemeOf→Tyrosine metabolism Lysine degradation→ThemeOf→D-alanine metabolism Tryptophan metabolism→ThemeOf→Tyrosine metabolism D-alanine metabolism→ThemeOf→Lysine degradation Phenylalanine metabolism→ThemeOf→reduced Lysine degradation→ThemeOf→Phenylalanine metabolism Tryptophan metabolism→ThemeOf→reduced D-alanine metabolism→ThemeOf→SC06 Phenylalanine metabolism→ThemeOf→D-alanine metabolism SC06→ThemeOf→Lysine degradation Tryptophan metabolism→ThemeOf→D-alanine metabolism D-alanine metabolism→ThemeOf→Tryptophan metabolism SC06→ThemeOf→Tryptophan metabolism Tryptophan metabolism→ThemeOf→Phenylalanine metabolism D-alanine metabolism→ThemeOf→Tyrosine metabolism SC06→ThemeOf→Tyrosine metabolism Tyrosine metabolism→ThemeOf→Lysine degradation D-alanine metabolism→ThemeOf→reduced SC06→CauseOf→reduced Tyrosine metabolism→ThemeOf→SC06 D-alanine metabolism→ThemeOf→Phenylalanine metabolism Lysine degradation→ThemeOf→SC06 SC06→ThemeOf→D-alanine metabolism Tyrosine metabolism→ThemeOf→Tryptophan metabolism Phenylalanine metabolism→ThemeOf→Lysine degradation Lysine degradation→ThemeOf→Tryptophan metabolism SC06→ThemeOf→Phenylalanine metabolism Tyrosine metabolism→ThemeOf→reduced Phenylalanine metabolism→ThemeOf→SC06 Lysine degradation→ThemeOf→Tyrosine metabolism Tryptophan metabolism→ThemeOf→Lysine degradation Tyrosine metabolism→ThemeOf→D-alanine metabolism Phenylalanine metabolism→ThemeOf→Tryptophan metabolism
395	35204173	7953	As displayed in Figure 10, DQ significantly increased the KEGG pathways at the first level, i.e., cellular processes, human diseases, genetic information and environmental information, whereas Bacillus pretreatments, particularly SC06 could reverse this trend.	SC06→CauseOf→increased
396	35204173	7958	The current study revealed the antioxidant functions of two Bacillus species, B. amyloliquefaciens SC06 and B. licheniformis SC08 in preventing liver injuries.	liver injuries→ThemeOf→SC06 liver injuries→ThemeOf→preventing liver injuries→ThemeOf→antioxidant antioxidant→ThemeOf→SC06 antioxidant→ThemeOf→liver injuries antioxidant→ThemeOf→preventing SC06→ThemeOf→liver injuries SC06→CauseOf→preventing SC06→ThemeOf→antioxidant
397	35204173	7960	For instance, Bacillus spores protected against acetaminophen-induced acute liver injury in rats.	acute liver injury→ThemeOf→protected acute liver injury→ThemeOf→acetaminophen-induced acetaminophen-induced→ThemeOf→Bacillus acetaminophen-induced→ThemeOf→acute liver injury acetaminophen-induced→ThemeOf→protected Bacillus→ThemeOf→acute liver injury Bacillus→CauseOf→protected Bacillus→ThemeOf→acetaminophen-induced acute liver injury→ThemeOf→Bacillus
398	35204173	7964	Whether Bacillus SC06 or SC08 modulates the functions of stellate cells to alleviate oxidative stress warrants further investigation.	functions of stellate cells→ThemeOf→modulates functions of stellate cells→ThemeOf→alleviate oxidative stress SC08→ThemeOf→functions of stellate cells SC08→CauseOf→modulates SC08→ThemeOf→alleviate oxidative stress SC06→ThemeOf→functions of stellate cells alleviate oxidative stress→ThemeOf→SC06 SC06→CauseOf→modulates alleviate oxidative stress→ThemeOf→functions of stellate cells SC06→ThemeOf→alleviate oxidative stress alleviate oxidative stress→ThemeOf→SC08 functions of stellate cells→ThemeOf→SC06 alleviate oxidative stress→ThemeOf→modulates functions of stellate cells→ThemeOf→SC08
399	35204173	7965	We also found that Bacillus SC06 showed stronger antioxidant capacity than SC08, as evidenced by the ameliorated hepatic injuries, decreased mitochondrial dysfunction and enhanced antioxidant levels under DQ exposure.	antioxidant→ThemeOf→enhanced antioxidant levels→ThemeOf→stronger SC06→ThemeOf→antioxidant levels decreased mitochondrial dysfunction→ThemeOf→stronger antioxidant→ThemeOf→antioxidant levels antioxidant levels→ThemeOf→decreased mitochondrial dysfunction SC06→ThemeOf→hepatic injuries antioxidant→ThemeOf→hepatic injuries hepatic injuries→ThemeOf→enhanced SC06→CauseOf→stronger antioxidant→ThemeOf→SC06 hepatic injuries→ThemeOf→antioxidant SC06→ThemeOf→decreased mitochondrial dysfunction antioxidant→ThemeOf→stronger hepatic injuries→ThemeOf→antioxidant levels stronger→CauseOf→enhanced antioxidant→ThemeOf→decreased mitochondrial dysfunction hepatic injuries→ThemeOf→SC06 decreased mitochondrial dysfunction→ThemeOf→enhanced antioxidant levels→ThemeOf→enhanced hepatic injuries→ThemeOf→stronger decreased mitochondrial dysfunction→ThemeOf→antioxidant antioxidant levels→ThemeOf→antioxidant hepatic injuries→ThemeOf→decreased mitochondrial dysfunction decreased mitochondrial dysfunction→ThemeOf→antioxidant levels antioxidant levels→ThemeOf→hepatic injuries SC06→CauseOf→enhanced decreased mitochondrial dysfunction→ThemeOf→hepatic injuries enhanced→CauseOf→stronger antioxidant levels→ThemeOf→SC06 SC06→ThemeOf→antioxidant decreased mitochondrial dysfunction→ThemeOf→SC06
400	35204173	7969	On the contrary, another report revealed that SIRT4 modulation of fatty acid metabolism reduced the levels of free fatty acids but unfortunately increased ROS production in obese patients with NAFLD.	ROS production→ThemeOf→increased SIRT4→ThemeOf→obese obese→ThemeOf→increased levels of free fatty acids→ThemeOf→reduced ROS production→ThemeOf→SIRT4 modulation→ThemeOf→levels of free fatty acids obese→ThemeOf→SIRT4 levels of free fatty acids→ThemeOf→ROS production ROS production→ThemeOf→modulation modulation→CauseOf→reduced obese→ThemeOf→modulation levels of free fatty acids→ThemeOf→increased ROS production→ThemeOf→obese modulation→ThemeOf→ROS production levels of free fatty acids→ThemeOf→SIRT4 increased→CauseOf→reduced modulation→CauseOf→increased levels of free fatty acids→ThemeOf→modulation SIRT4→ThemeOf→levels of free fatty acids modulation→ThemeOf→SIRT4 levels of free fatty acids→ThemeOf→obese SIRT4→ThemeOf→reduced modulation→ThemeOf→obese reduced→CauseOf→increased SIRT4→ThemeOf→ROS production obese→ThemeOf→levels of free fatty acids ROS production→ThemeOf→levels of free fatty acids SIRT4→ThemeOf→increased obese→ThemeOf→reduced ROS production→ThemeOf→reduced SIRT4→ThemeOf→modulation obese→ThemeOf→ROS production
401	35204173	7970	In our study, Bacillus SC06 significantly decreased the mitochondrial dysfunction in DQ-exposed rats, but whether SIRT4 participated in this process was not investigated.	Bacillus→CauseOf→decreased Bacillus→ThemeOf→mitochondrial dysfunction mitochondrial dysfunction→ThemeOf→Bacillus mitochondrial dysfunction→ThemeOf→decreased mitochondrial dysfunction→ThemeOf→SC06 SC06→CauseOf→decreased SC06→ThemeOf→mitochondrial dysfunction
402	35204173	7971	Nevertheless, another study in our lab showed that SC06 could activate SIRT1/FOXO3 signaling to alleviate oxidative stress in IPEC-J2 cells.	FOXO3→ThemeOf→SC06 activate→CauseOf→alleviate FOXO3→ThemeOf→activate alleviate→CauseOf→activate FOXO3→ThemeOf→alleviate SC06→ThemeOf→FOXO3 SC06→ThemeOf→SIRT1 SC06→CauseOf→activate SC06→CauseOf→alleviate SIRT1→ThemeOf→SC06 SIRT1→ThemeOf→activate SIRT1→ThemeOf→alleviate
403	35204173	7974	By using 16S rRNA sequencing analysis, we demonstrated that Bacillus SC06 protected the liver against oxidative stress by altering gut microbiota.	gut microbiota→ThemeOf→protected altering→CauseOf→protected SC06→ThemeOf→gut microbiota protected→CauseOf→altering Bacillus→ThemeOf→gut microbiota SC06→ThemeOf→liver against oxidative stress Bacillus→ThemeOf→liver against oxidative stress SC06→CauseOf→altering Bacillus→CauseOf→altering SC06→CauseOf→protected Bacillus→CauseOf→protected liver against oxidative stress→ThemeOf→Bacillus gut microbiota→ThemeOf→Bacillus liver against oxidative stress→ThemeOf→gut microbiota gut microbiota→ThemeOf→SC06 liver against oxidative stress→ThemeOf→SC06 gut microbiota→ThemeOf→liver against oxidative stress liver against oxidative stress→ThemeOf→altering gut microbiota→ThemeOf→altering liver against oxidative stress→ThemeOf→protected
404	35204173	7975	Evidence suggested that modulation of gut microbiota have the potential to control hepatic cellular stress and treat liver diseases of different etiologies.	hepatic cellular stress→ThemeOf→modulation modulation→ThemeOf→gut microbiota hepatic cellular stress→ThemeOf→treat modulation→CauseOf→control liver diseases→ThemeOf→hepatic cellular stress gut microbiota→ThemeOf→liver diseases modulation→CauseOf→treat liver diseases→ThemeOf→gut microbiota gut microbiota→ThemeOf→hepatic cellular stress treat→CauseOf→control liver diseases→ThemeOf→control gut microbiota→ThemeOf→control liver diseases→ThemeOf→modulation gut microbiota→ThemeOf→modulation liver diseases→ThemeOf→treat gut microbiota→ThemeOf→treat hepatic cellular stress→ThemeOf→liver diseases control→CauseOf→treat hepatic cellular stress→ThemeOf→gut microbiota modulation→ThemeOf→liver diseases hepatic cellular stress→ThemeOf→control modulation→ThemeOf→hepatic cellular stress
405	35204173	7986	Compared to the DQ group, SC06 pretreatment markedly upregulated the richness of g_Anaerofilum, s_Bacteroides uniformis and downregulated s_Oscillospira guilliermondii.	SC06→ThemeOf→richness richness→ThemeOf→upregulated SC06→CauseOf→upregulated richness→ThemeOf→downregulated SC06→CauseOf→downregulated upregulated→CauseOf→downregulated s_Oscillospira→ThemeOf→SC06 downregulated→CauseOf→upregulated s_Bacteroides→ThemeOf→SC06 s_Oscillospira→ThemeOf→richness s_Bacteroides→ThemeOf→richness s_Oscillospira→ThemeOf→upregulated s_Bacteroides→ThemeOf→upregulated s_Oscillospira→ThemeOf→downregulated s_Bacteroides→ThemeOf→downregulated richness→ThemeOf→s_Bacteroides SC06→ThemeOf→s_Bacteroides richness→ThemeOf→SC06 SC06→ThemeOf→s_Oscillospira richness→ThemeOf→s_Oscillospira
406	35204173	7991	Therefore, our findings suggest that SC06 could optimize the composition of gut microbiota and restore the gut dysbiosis induced by DQ exposure.	composition of gut microbiota→ThemeOf→optimize composition of gut microbiota→ThemeOf→SC06 restore→CauseOf→optimize optimize→CauseOf→restore SC06→ThemeOf→composition of gut microbiota SC06→CauseOf→restore SC06→CauseOf→optimize composition of gut microbiota→ThemeOf→restore
407	35204173	7992	Co-occurrence networks provide insight into microbial interactions, and we found that the average degree and graph density of microbial network in Bacillus groups were higher than those of the other groups, suggesting that Bacillus pretreatments increased microbe connections.	microbe→ThemeOf→higher higher→CauseOf→increased Bacillus→CauseOf→microbe Bacillus→CauseOf→increased Bacillus→CauseOf→graph density Bacillus→CauseOf→higher increased→CauseOf→higher microbe→CauseOf→Bacillus graph density→CauseOf→Bacillus microbe→ThemeOf→increased
408	35204173	7994	Results of Pearson's correlation showed that the beneficial microbes such as Lactobacillus, Faecalibacterium and Butyricicoccus exhibited a negative correlation with MDA, whereas g_Escherichia and g_Shigella were positively correlated with ALT and AST, which further confirmed that the alteration of microbiota composition was related to attenuating oxidative stress-induced liver injuries.	g_Escherichia→CauseOf→attenuating MDA→ThemeOf→liver injuries MDA→ThemeOf→attenuating MDA→ThemeOf→g_Escherichia liver injuries→ThemeOf→MDA liver injuries→ThemeOf→attenuating liver injuries→ThemeOf→g_Escherichia g_Escherichia→ThemeOf→MDA g_Escherichia→ThemeOf→liver injuries
409	35204173	7995	The functional KEGG annotation analyses of metagenomic study indicated that Bacillus administration, particularly SC06 could inhibit the microbial metabolic pathways including carbohydrate metabolism, lipid metabolism, amino acid metabolism and metabolism of cofactors and vitamins).	SC06→CauseOf→inhibit
410	35204173	7996	SC06 pretreatment markedly decreased the gene enrichment of carbohydrates such as galactose metabolism.	SC06→CauseOf→decreased
411	35204173	8000	Moreover, SC06 could decrease amino acid metabolism, particularly for phenylalanine and tryptophan.	amino acid metabolism→ThemeOf→decrease amino acid metabolism→ThemeOf→SC06 SC06→CauseOf→decrease SC06→ThemeOf→amino acid metabolism
412	35204173	8006	Studies also found that tryptophan takes an important part in the biofilm formation of pathogens such as Salmonella Typhimurium; deletion of tryptophan genes led to the decreased bacterial attachment and biofilm defect.	biofilm defect→ThemeOf→decreased tryptophan→ThemeOf→bacterial attachment biofilm defect→ThemeOf→bacterial attachment tryptophan→ThemeOf→deletion biofilm defect→ThemeOf→tryptophan deletion→CauseOf→decreased biofilm defect→ThemeOf→deletion deletion→ThemeOf→biofilm defect bacterial attachment→ThemeOf→decreased deletion→ThemeOf→bacterial attachment bacterial attachment→ThemeOf→biofilm defect deletion→ThemeOf→tryptophan bacterial attachment→ThemeOf→tryptophan bacterial attachment→ThemeOf→deletion tryptophan→ThemeOf→decreased tryptophan→ThemeOf→biofilm defect
413	35204173	8010	For instance, Van De Lagemaat found that B Vitamins scavenge reactive oxygen species and modulate immune cytokines to reduce oxidative stress; supplementation with B vitamins enhanced the anti-oxidative state in patients with liver cancer.	supplementation→CauseOf→enhanced
414	35204173	8015	SC06 significantly decreased the gene enrichment involved in cellular processes such as bacterial chemotaxis, flagellar assembly and biofilm formation.	gene enrichment→ThemeOf→decreased gene enrichment→ThemeOf→SC06 SC06→CauseOf→decreased SC06→ThemeOf→gene enrichment
415	35204173	8021	In our study, SC06 significantly downregulated the expression of the key genes involved in the pathways for bacterial chemotaxis, flagella assembly and biofilm formation, suggesting its potential ability to inhibit pathogen growth and colonization.	SC06→CauseOf→downregulated SC06→CauseOf→inhibit inhibit→CauseOf→downregulated downregulated→CauseOf→inhibit
416	35204173	8022	Results also revealed that SC06 pretreatment decreased the gene enrichment of bacterial secretion systems.	SC06→CauseOf→decreased
417	35204173	8024	These results confirmed SC06 administration downregulated the pathways associated with the pathogenicity of opportunistic pathogens, and exerted a protective role in alleviating oxidative stress- induced microbiota imbalance.	SC06→CauseOf→downregulated
418	35204173	8025	In conclusion, Bacillus SC06 alleviated oxidative stress-induced live injuries via modulating the composition, and pathways for metabolism and bacterial replication and secretion of gut microbiota.	oxidative stress-induced→ThemeOf→alleviated Bacillus→CauseOf→alleviated oxidative stress-induced→ThemeOf→modulating Bacillus→CauseOf→modulating SC06→ThemeOf→oxidative stress-induced SC06→ThemeOf→composition composition→ThemeOf→SC06 composition→ThemeOf→Bacillus alleviated→CauseOf→modulating SC06→CauseOf→alleviated modulating→CauseOf→alleviated oxidative stress-induced→ThemeOf→SC06 SC06→CauseOf→modulating composition→ThemeOf→alleviated oxidative stress-induced→ThemeOf→Bacillus Bacillus→ThemeOf→oxidative stress-induced composition→ThemeOf→modulating Bacillus→ThemeOf→composition
419	35265049	8044	The total organic carbon (%TOC) was dosed by organic matter oxidation using K2Cr2O7 according to.	organic matter oxidation→ThemeOf→K2Cr2O7 K2Cr2O7→ThemeOf→total organic carbon K2Cr2O7→ThemeOf→organic matter oxidation total organic carbon→ThemeOf→organic matter oxidation total organic carbon→ThemeOf→K2Cr2O7 organic matter oxidation→ThemeOf→total organic carbon
420	35265049	8072	In the initial mixture (Figure 3C), the fungal microbiome was dominated by four species (> 5%), namely, Dipodascus australiensis (33.18%), Penicillium roqueforti (27.27%), Pichia sp.	Penicillium→ThemeOf→Pichia Penicillium→ThemeOf→fungal microbiome fungal microbiome→ThemeOf→Dipodascus australiensis Dipodascus australiensis→ThemeOf→Pichia fungal microbiome→ThemeOf→Pichia Dipodascus australiensis→ThemeOf→Penicillium fungal microbiome→ThemeOf→Penicillium Dipodascus australiensis→ThemeOf→fungal microbiome Pichia→ThemeOf→Dipodascus australiensis Pichia→ThemeOf→Penicillium Pichia→ThemeOf→fungal microbiome Penicillium→ThemeOf→Dipodascus australiensis
421	35265049	8074	Similarly, the bacterial microbiome (Figure 3D) was dominated by Psychrobacter aquaticus (30.3%), Corynebacterium variabile (28.7%), Carnobacterium maltaromaticum (11.5%), and Psychrobacter pulmonis (9.7%).	Carnobacterium→ThemeOf→Psychrobacter pulmonis Carnobacterium→ThemeOf→bacterial Carnobacterium→ThemeOf→Psychrobacter aquaticus bacterial→ThemeOf→Corynebacterium variabile bacterial→ThemeOf→Psychrobacter pulmonis Corynebacterium variabile→ThemeOf→Carnobacterium bacterial→ThemeOf→Carnobacterium Corynebacterium variabile→ThemeOf→bacterial bacterial→ThemeOf→Psychrobacter aquaticus Psychrobacter pulmonis→ThemeOf→Carnobacterium Psychrobacter aquaticus→ThemeOf→Carnobacterium Psychrobacter pulmonis→ThemeOf→bacterial Psychrobacter aquaticus→ThemeOf→bacterial Carnobacterium→ThemeOf→Corynebacterium variabile
422	35265049	8075	By the end of thermophilic phase, major changes were observed in taxa abundancy (Figure 3C), as the compost was dominated by only two fungal and three bacterial species, namely, Candida freyschussii (87.3%), Sporopachydermia lactativora (10.6%), Pseudomonas syringae (47.8%), Actinobacter sp.	Pseudomonas syringae→ThemeOf→Sporopachydermia Actinobacter→ThemeOf→taxa Actinobacter→ThemeOf→Sporopachydermia taxa→ThemeOf→Pseudomonas syringae taxa→ThemeOf→Actinobacter taxa→ThemeOf→Sporopachydermia Sporopachydermia→ThemeOf→Pseudomonas syringae Sporopachydermia→ThemeOf→Actinobacter Sporopachydermia→ThemeOf→taxa Pseudomonas syringae→ThemeOf→taxa
423	35265049	8081	(7.1%), Brevibacterium linens (7%) and Arthrobacter protophormiae (5.3%), followed by Isoptericola sp.	Isoptericola→ThemeOf→Arthrobacter Brevibacterium→ThemeOf→Isoptericola Arthrobacter→ThemeOf→Isoptericola Isoptericola→ThemeOf→Brevibacterium
424	35295308	8137	Particularly large numbers of G2Is were found in the family Phormidiaceae, which includes Arthrospira platensis.	G2Is→CauseOf→found
425	35335231	8154	Comparative Genomic Analysis Reveals Intestinal Habitat Adaptation of Ligilactobacillus equi Rich in Prophage and Degrading Cellulase Ligilactobacillus equi is common in the horse intestine, alleviates the infection of Salmonella, and regulates intestinal flora.	regulates→CauseOf→alleviates infection→ThemeOf→Ligilactobacillus intestinal flora→ThemeOf→Salmonella Ligilactobacillus→ThemeOf→Salmonella infection→ThemeOf→alleviates intestinal flora→ThemeOf→regulates Ligilactobacillus→ThemeOf→regulates infection→ThemeOf→Degrading intestinal flora→ThemeOf→Ligilactobacillus Ligilactobacillus→ThemeOf→alleviates infection→ThemeOf→intestinal flora intestinal flora→ThemeOf→alleviates Salmonella→ThemeOf→regulates Ligilactobacillus→ThemeOf→infection Degrading→ThemeOf→Salmonella intestinal flora→ThemeOf→infection Salmonella→ThemeOf→Ligilactobacillus Ligilactobacillus→ThemeOf→Degrading Degrading→CauseOf→regulates intestinal flora→ThemeOf→Degrading Salmonella→ThemeOf→alleviates Ligilactobacillus→ThemeOf→intestinal flora Degrading→ThemeOf→Ligilactobacillus Salmonella→ThemeOf→infection alleviates→CauseOf→regulates Degrading→CauseOf→alleviates Salmonella→ThemeOf→Degrading infection→ThemeOf→Salmonella Degrading→ThemeOf→infection Salmonella→ThemeOf→intestinal flora infection→ThemeOf→regulates Degrading→ThemeOf→intestinal flora
426	35335231	8167	One study of strains from horse feces samples showed that all samples contained Ligilactobacillus hayakitensis, Limosilactobacillus equigenerosi, and L. equi.	Ligilactobacillus→CauseOf→contained Ligilactobacillus→ThemeOf→Limosilactobacillus equigenerosi Limosilactobacillus equigenerosi→ThemeOf→contained Limosilactobacillus equigenerosi→ThemeOf→Ligilactobacillus
427	35335231	8179	Among the four strains of L. equi, strain IMAU81196 had the smallest genome (1.95 Mbp) and the largest GC content (39.5%).	GC content→ThemeOf→smallest GC content→ThemeOf→IMAU81196 IMAU81196→ThemeOf→GC content IMAU81196→CauseOf→smallest
428	35335231	8198	The ANI value of IMAU81196 and DPC 6820 was 98.44%, which was the highest of all strains, indicating that the base and nucleic acid match between IMAU81196 and DPC 6820 was higher.	IMAU81196→CauseOf→higher IMAU81196→ThemeOf→base base→ThemeOf→IMAU81196 base→ThemeOf→higher
429	35335231	8199	The ANI value of strains JCM 10991T and DSM 15833T was 99.95%, indicating that there are differences between the homologous gene regions of these two strains.	DSM 15833T→ThemeOf→ANI JCM 10991T→ThemeOf→ANI ANI→ThemeOf→DSM 15833T ANI→ThemeOf→JCM 10991T
430	35335231	8205	From the perspective of the phylogenetic tree, the evolutionary divergence time between L. equi IMAU81196 and L. equi DPC 6820 is shorter, and the genetic relationship is closer.	evolutionary divergence→ThemeOf→shorter evolutionary divergence→ThemeOf→DPC 6820 DPC 6820→ThemeOf→evolutionary divergence DPC 6820→CauseOf→shorter
431	35335231	8206	The results showed that a mean of 747 protein-coding genes was annotated in the four strains of L. equi, among which L. equi JCM 10991T had the most genes (828), and the remaining three strains had about 720 genes.	L. equi JCM 10991T→ThemeOf→L. equi L. equi→ThemeOf→L. equi JCM 10991T
432	35335231	8213	The fewest carbohydrate genes were found in L. equi DPC 6820 (85 genes representing 11.92% of all genes).	DPC 6820→CauseOf→fewest
433	35335231	8214	It can be seen from the figure that DSM 15833T has fewer genes than JCM 10991T in each gene category, and there are obvious differences in nucleosides, nucleotides, and membrane transport.	DSM 15833T→ThemeOf→membrane transport DSM 15833T→CauseOf→fewer nucleosides→ThemeOf→DSM 15833T nucleosides→ThemeOf→membrane transport nucleosides→ThemeOf→fewer membrane transport→ThemeOf→DSM 15833T membrane transport→ThemeOf→nucleosides membrane transport→ThemeOf→fewer DSM 15833T→ThemeOf→nucleosides
434	35335231	8227	IMAU81196 unique genes were mainly involved in the metabolism of carbohydrates.	metabolism of carbohydrates→ThemeOf→IMAU81196 metabolism of carbohydrates→ThemeOf→involved IMAU81196→ThemeOf→metabolism of carbohydrates IMAU81196→CauseOf→involved
435	35335231	8249	This is a diverse family, transferring sugar from UDP-glucose, UDP-N-acetyl-galactosamine, GDP-mannose, or CDP-abequose to a range of substrates, including cellulose, dolichol phosphate, and teichoic acids.	UDP-glucose→ThemeOf→dolichol phosphate sugar→ThemeOf→transferring sugar→ThemeOf→dolichol phosphate sugar→ThemeOf→UDP-glucose dolichol phosphate→ThemeOf→transferring dolichol phosphate→ThemeOf→sugar dolichol phosphate→ThemeOf→UDP-glucose UDP-glucose→CauseOf→transferring UDP-glucose→ThemeOf→sugar
436	35347213	8316	These ARGs were the following: aadA2, ant(6)-Ia, ant(9)-Ia, aph(3')-IIa, aph(3')-IIIa, dfrG, erm(44)v, lmrD, lsaE, poxtA, qnrD1, qnrS1, sul1, sul2, tet(K), vatE (Fig.	lmrD→ThemeOf→sul1 aadA2→ThemeOf→sul2 sul2→ThemeOf→lmrD qnrS1→ThemeOf→lmrD lmrD→ThemeOf→aadA2 aph→CauseOf→qnrS1 sul2→ThemeOf→aadA2 qnrS1→ThemeOf→aadA2 lmrD→CauseOf→aph aph→CauseOf→sul1 sul2→CauseOf→aph qnrS1→CauseOf→aph lmrD→ThemeOf→qnrD1 aph→CauseOf→lmrD sul2→CauseOf→aph qnrS1→CauseOf→aph lmrD→ThemeOf→sul2 aph→CauseOf→qnrD1 aph→CauseOf→qnrS1 sul1→ThemeOf→lmrD lmrD→CauseOf→aph aph→CauseOf→sul2 aph→CauseOf→sul1 sul1→ThemeOf→aadA2 aadA2→ThemeOf→qnrS1 qnrD1→ThemeOf→lmrD aph→CauseOf→lmrD sul1→CauseOf→aph aadA2→ThemeOf→sul1 qnrD1→ThemeOf→aadA2 aph→CauseOf→qnrD1 sul1→CauseOf→aph aadA2→ThemeOf→lmrD qnrD1→CauseOf→aph aph→CauseOf→sul2 lmrD→ThemeOf→qnrS1 aadA2→ThemeOf→qnrD1 qnrD1→CauseOf→aph
437	35347213	8406	The presence of several ARGs presumably associated with iMGEs in the feed of dairy cows harbors the potential to affect the resident microbiota of the animals.	associated→CauseOf→affect ARGs→CauseOf→associated ARGs→CauseOf→affect affect→CauseOf→associated
438	35347213	8409	Furthermore, ARGs can possibly spread further, to lower gastrointestinal (GI) regions.	lower gastrointestinal→ThemeOf→ARGs ARGs→ThemeOf→lower gastrointestinal
439	35564054	8445	In conclusion, a ddPCR can be a reliable method for detecting and quantifying lactic acid bacteria in food.	lactic→ThemeOf→ddPCR ddPCR→ThemeOf→lactic
440	35564054	8455	argentoratensis affected the fermentation stage of vegetables, such as kimchi.	argentoratensis→CauseOf→affected
441	35637757	8565	DS1 as the evaluation index, the primary and secondary order of the four factors affecting the degradation rate is concentration > material size > temperature > time, and the optimal extraction condition is A3B3C3D2.	degradation→ThemeOf→A3B3C3D2 A3B3C3D2→ThemeOf→degradation
442	35637757	8575	When the concentration of hydrochloric acid increases, although hydroxyl-beta-sanshool is more stable than hydroxyl-alpha-sanshool, due to its highly unsaturated nature, it also eventually isomerizes.	hydroxyl-beta-sanshool→ThemeOf→isomerizes isomerizes→ThemeOf→hydroxyl-beta-sanshool
443	35637757	8614	3(f)) is as follows: First, hydroxyl-alpha-sanshool was converted to hydroxyl-beta-sanshool, and then the carbonyl bond of hydroxyl-beta-sanshool was broken, which leads to isomerization and isomer formation under the action of hydrochloric acid: (1Z,2E,4E,8E,10E)-n-(2-hydroxy-2-methylpropyl)dodeca-2,4,8,10-tetraenimidic acid.	1Z,2E,4E,8E,10E→ThemeOf→isomer formation 1Z,2E,4E,8E,10E→CauseOf→leads to isomerization→ThemeOf→1Z,2E,4E,8E,10E isomerization→ThemeOf→leads to isomer formation→ThemeOf→1Z,2E,4E,8E,10E isomer formation→ThemeOf→leads to 1Z,2E,4E,8E,10E→ThemeOf→isomerization
444	35677055	8641	SLE is distinguished by the presence of high-titer serological autoantibodies, such as antibodies that bind to double-stranded DNA (dsDNA), SmRNP, SSA/Ro, and SSB/La.	SmRNP→ThemeOf→SSB/La SmRNP→ThemeOf→SLE SSB/La→ThemeOf→SSA/Ro SSB/La→ThemeOf→SLE SSB/La→ThemeOf→SmRNP SSA/Ro→ThemeOf→SSB/La SSA/Ro→ThemeOf→SLE SLE→ThemeOf→SSB/La SLE→ThemeOf→SSA/Ro SLE→ThemeOf→SmRNP
445	35677055	8660	For example, L. delbrueckii and L. rhamnosus have been shown to be effective in the elevation of Tregs and the decrease of inflammatory cytokines and disease severity in SLE-induced mice.	L. delbrueckii→CauseOf→elevation decrease→CauseOf→elevation L. rhamnosus→CauseOf→decrease elevation→CauseOf→decrease L. delbrueckii→CauseOf→decrease L. rhamnosus→CauseOf→elevation
446	35677055	8708	Moreover, L. delbrueckii and L. rhamnosus could decrease expression of CXCR3, CCR5, CCR4, and CCR3 on the tolerogenic phenotype of DCs in SLE patients.	CCR5→ThemeOf→expression expression→ThemeOf→L. delbrueckii CCR3→ThemeOf→expression CCR5→ThemeOf→L. delbrueckii expression→ThemeOf→CCR3 CCR3→ThemeOf→L. delbrueckii SLE→ThemeOf→CCR5 CCR4→ThemeOf→SLE CCR4→ThemeOf→decrease L. delbrueckii→ThemeOf→CCR5 SLE→ThemeOf→CCR4 CCR4→ThemeOf→expression L. delbrueckii→CauseOf→decrease CCR4→ThemeOf→L. delbrueckii L. delbrueckii→ThemeOf→CCR4 L. delbrueckii→ThemeOf→expression SLE→ThemeOf→CCR3 expression→ThemeOf→CCR5 L. delbrueckii→ThemeOf→CCR3 CCR5→ThemeOf→SLE CCR3→ThemeOf→SLE CCR5→ThemeOf→decrease expression→ThemeOf→CCR4 CCR3→ThemeOf→decrease
447	35677055	8709	Another study showed that Lactobacillus plantarum NCU116 increased the expression levels of Th17, Treg and specific transcription factors RORgammat and Foxp3 in CTX-induced immunosuppression mice.	NCU116→ThemeOf→RORgammat Th17→ThemeOf→increased NCU116→ThemeOf→Th17 Foxp3→ThemeOf→expression levels expression levels→ThemeOf→increased Foxp3→ThemeOf→NCU116 expression levels→ThemeOf→Foxp3 Foxp3→ThemeOf→increased expression levels→ThemeOf→RORgammat RORgammat→ThemeOf→expression levels expression levels→ThemeOf→Th17 RORgammat→ThemeOf→NCU116 RORgammat→ThemeOf→increased NCU116→CauseOf→increased Th17→ThemeOf→expression levels NCU116→ThemeOf→Foxp3 Th17→ThemeOf→NCU116
448	35677055	8716	In addition, a randomized trial demonstrated that LGG has an immediate effect in the human gut with upregulating genes related to B cell activation.	gut→ThemeOf→B cell activation gut→ThemeOf→LGG gut→ThemeOf→upregulating B cell activation→ThemeOf→gut B cell activation→ThemeOf→LGG B cell activation→ThemeOf→upregulating LGG→ThemeOf→gut LGG→ThemeOf→B cell activation LGG→CauseOf→upregulating
449	35677055	8717	After administration of Lactobacillus paracasei MCC1849, IgA secretion was elevated and Follicular helper T (Tfh) cells was induced in the BALB/c mice.	induced→CauseOf→elevated elevated→CauseOf→induced MCC1849→CauseOf→induced MCC1849→CauseOf→elevated
450	35677055	8721	Dysregulation of Tregs and Th1/Th2/Th17 are involved in the pathogenesis of SLE.	Dysregulation→ThemeOf→Tregs Dysregulation→CauseOf→involved Tregs→ThemeOf→Dysregulation Tregs→ThemeOf→involved
451	35677055	8763	To our best knowledge, although there were no adverse effects on the RCT trials of Lactobacillus on inflammatory bowel disease and rheumatoid arthritis, the adverse effects of Lactobacillus as probiotics must be further investigated utilizing additional antibiotic regimens, probiotic strain combinations, and human microbiome transplants into germ-free mice.	inflammatory bowel disease→ThemeOf→Lactobacillus Lactobacillus→ThemeOf→rheumatoid arthritis Lactobacillus→ThemeOf→inflammatory bowel disease rheumatoid arthritis→ThemeOf→inflammatory bowel disease rheumatoid arthritis→ThemeOf→Lactobacillus inflammatory bowel disease→ThemeOf→rheumatoid arthritis
452	35693762	8794	In humans, Vgamma9Vdelta2 T cells are predominant circulating gammadelta T cells, whereas Vdelta1+ cells and fetal gammadelta T cells are commonly tissue-resident cells.	gammadelta T→ThemeOf→Vgamma9Vdelta2 Vgamma9Vdelta2→ThemeOf→gammadelta T
453	35693762	8795	In addition to their ability to release cytokines, subsets of gammadelta cells possess NK-like cytotoxicity via NK receptors, such as NKG2D.	cytotoxicity→ThemeOf→gammadelta NK-like→ThemeOf→NKG2D NK-like→ThemeOf→gammadelta gammadelta→ThemeOf→NKG2D gammadelta→ThemeOf→cytotoxicity NKG2D→ThemeOf→NK-like gammadelta→ThemeOf→NK-like NKG2D→ThemeOf→gammadelta
454	35693762	8801	DN T cells are subdivided into four differentiation stages (DN1: CD44+CD25-; DN2: CD44+CD25+; DN3: CD44-CD25+; DN4: CD44-CD25-) (Figure 1B).	CD44+CD25-→ThemeOf→DN1 DN4→ThemeOf→CD44+CD25- DN1→ThemeOf→CD44+CD25- CD44+CD25-→ThemeOf→DN4
455	35693762	8803	Then, DP T cells interact with cortical epithelial cells expressing MHC molecules with self-antigens, which leads to a selection process where too weak signaling induces DP cell apoptosis.	weak→CauseOf→induces induces→CauseOf→weak too→CauseOf→weak too→CauseOf→induces
456	35693762	8818	Although fetal Vgamma9Vdelta2 T cells slowly turn over and have self-renewal capacity, adult-derived Vgamma9Vdelta2 T cells can also be generated and be a major source human gammadelta T cells in the blood.	Vgamma9Vdelta2→CauseOf→self-renewal capacity self-renewal capacity→CauseOf→Vgamma9Vdelta2
457	35693762	8821	CD27+CD44int cells actively secrete IFN-gamma, whereas CD27-CD44hi cells produce IL-17A.	CD27+CD44int→ThemeOf→secrete IFN-gamma secrete IFN-gamma→ThemeOf→CD27+CD44int
458	35693762	8822	If gammadeltaTCR is weak, cells tend to preferentially differentiate into alphabeta T cells.	gammadeltaTCR→CauseOf→weak alphabeta T→ThemeOf→gammadeltaTCR alphabeta T→ThemeOf→weak gammadeltaTCR→ThemeOf→alphabeta T
459	35693762	8844	T10/22, a MHC class Ib molecule, is also important for gammadelta T cell development.	T10/22→ThemeOf→gammadelta T cell development T10/22→CauseOf→important gammadelta T cell development→ThemeOf→T10/22 gammadelta T cell development→ThemeOf→important
460	35693762	8846	Phosphoantigens induce a conformational change in BTN3A1-BTN2A1 dimers, which binds to Vgamma9Vdelta2 TCR.	TCR→ThemeOf→induce conformational→ThemeOf→Vgamma9Vdelta2 induce→CauseOf→binds TCR→ThemeOf→binds conformational→ThemeOf→induce binds→CauseOf→induce TCR→ThemeOf→BTN3A1 conformational→ThemeOf→binds BTN3A1→ThemeOf→TCR BTN2A1→ThemeOf→TCR conformational→ThemeOf→BTN3A1 BTN3A1→ThemeOf→conformational BTN2A1→ThemeOf→conformational Vgamma9Vdelta2→ThemeOf→TCR BTN3A1→ThemeOf→Vgamma9Vdelta2 BTN2A1→ThemeOf→Vgamma9Vdelta2 Vgamma9Vdelta2→ThemeOf→BTN2A1 BTN3A1→ThemeOf→induce BTN2A1→ThemeOf→induce Vgamma9Vdelta2→ThemeOf→conformational BTN3A1→ThemeOf→binds TCR→ThemeOf→BTN2A1 BTN2A1→ThemeOf→binds Vgamma9Vdelta2→CauseOf→induce TCR→ThemeOf→conformational conformational→ThemeOf→TCR Vgamma9Vdelta2→CauseOf→binds TCR→ThemeOf→Vgamma9Vdelta2 conformational→ThemeOf→BTN2A1 Vgamma9Vdelta2→ThemeOf→BTN3A1
461	35693762	8848	Contrary to a number of reports that argued fetal thymus-derived gammadelta T cells are invariant, adult-derived gammadelta T cells have relatively variant TCR chains.	TCR chains→ThemeOf→gammadelta gammadelta→ThemeOf→variant gammadelta→ThemeOf→TCR chains variant→CauseOf→TCR chains variant→ThemeOf→gammadelta TCR chains→CauseOf→variant
462	35693762	8850	In some cases, gammadelta T cells can be activated without TCR signaling, but activated by stress-induced molecules, such as MHC class I chain-related protein A/B (MICA/B) or retinoic acid early inducible 1 (Rae-1), via NKG2D receptor.	NKG2D receptor→ThemeOf→activated MHC→ThemeOf→Rae-1 NKG2D receptor→ThemeOf→MHC MHC→CauseOf→activated NKG2D receptor→ThemeOf→activated activated→CauseOf→activated gammadelta T cells→ThemeOf→activated Rae-1→ThemeOf→gammadelta T cells gammadelta T cells→ThemeOf→NKG2D receptor Rae-1→ThemeOf→activated gammadelta T cells→ThemeOf→Rae-1 Rae-1→ThemeOf→MHC gammadelta T cells→ThemeOf→MHC Rae-1→ThemeOf→activated gammadelta T cells→ThemeOf→activated MHC→ThemeOf→gammadelta T cells activated→CauseOf→activated MHC→CauseOf→activated NKG2D receptor→ThemeOf→gammadelta T cells MHC→ThemeOf→NKG2D receptor
463	35693762	8875	However, because these phenotypes were not repeated under microglia- or astrocyte-specific deletion of IL-17R, direct evidence linking IL-17A and memory formation is still lacking and should be further addressed.	deletion→ThemeOf→IL-17R deletion→ThemeOf→memory formation IL-17R→ThemeOf→deletion IL-17R→ThemeOf→memory formation memory formation→ThemeOf→deletion memory formation→ThemeOf→IL-17R
464	35693762	8879	Given the authors showed conditional deletion of Rorc using CD4-Cre mice, they concluded CD4 T cells are responsible for IL-17A production.	deletion→ThemeOf→Rorc IL-17A production→ThemeOf→deletion IL-17A production→ThemeOf→Rorc Rorc→ThemeOf→deletion Rorc→ThemeOf→IL-17A production deletion→ThemeOf→IL-17A production
465	35693762	8893	On the other hand, Vdelta2+ T cells have strong cytotoxicity against oligodendrocytes.	cytotoxicity→ThemeOf→Vdelta2+ T cells Vdelta2+ T cells→ThemeOf→cytotoxicity
466	35693762	8897	Another study showed that gut L. acidipiscis reduces Vgamma4+ cells while Vgamma1+ cells were increased.	Vgamma1+ cells→ThemeOf→increased increased→CauseOf→reduces L. acidipiscis→CauseOf→increased reduces→CauseOf→increased L. acidipiscis→CauseOf→reduces Vgamma4+ cells→ThemeOf→increased
467	35693762	8906	While CD4 T cells induce tumor necrosis factor (TNF) production by macrophages via IFN-gamma, gammadelta T cells promote neutrophil infiltration through IL-17A (Figure 2C).	CD4→ThemeOf→tumor necrosis factor tumor necrosis factor→ThemeOf→induce CD4→CauseOf→induce induce→CauseOf→promote TNF→ThemeOf→promote TNF→ThemeOf→CD4 TNF→ThemeOf→induce promote→CauseOf→induce CD4→ThemeOf→TNF tumor necrosis factor→ThemeOf→promote CD4→CauseOf→promote tumor necrosis factor→ThemeOf→CD4
468	35693762	8941	IL-6 knock out mice have more CD8 T cells and less CD4 T cells and gammadelta T cells compared to WT mice.	knock out→ThemeOf→IL-6 CD4→ThemeOf→gammadelta CD8→ThemeOf→knock out knock out→ThemeOf→CD4 CD4→ThemeOf→CD8 CD8→ThemeOf→CD4 knock out→CauseOf→less less→CauseOf→more CD8→ThemeOf→less knock out→CauseOf→more more→CauseOf→less CD8→ThemeOf→more knock out→ThemeOf→gammadelta gammadelta→ThemeOf→IL-6 CD8→ThemeOf→gammadelta IL-6→ThemeOf→knock out knock out→ThemeOf→CD8 gammadelta→ThemeOf→knock out IL-6→ThemeOf→CD4 CD4→ThemeOf→IL-6 gammadelta→ThemeOf→CD4 IL-6→ThemeOf→less CD4→ThemeOf→knock out gammadelta→ThemeOf→less IL-6→ThemeOf→more CD4→ThemeOf→less gammadelta→ThemeOf→more IL-6→ThemeOf→gammadelta CD4→ThemeOf→more gammadelta→ThemeOf→CD8
469	35693762	8967	A study showed gammadelta T cell were mostly correlated to better prognosis among multiple tumor-infiltrating immune cells.	tumor→ThemeOf→gammadelta tumor→ThemeOf→correlated gammadelta→ThemeOf→tumor gammadelta→CauseOf→correlated
470	35693762	8971	Also, our group showed gammadelta T cells are associated with longer survival of brain tumor patients.	gammadelta T cells→CauseOf→longer brain tumor→ThemeOf→gammadelta T cells brain tumor→ThemeOf→longer gammadelta T cells→ThemeOf→brain tumor
471	35693762	8979	In this study, anti-gammadeltaTCR antibody administration also abrogated gammadelta T cell-mediated antitumor functions.	anti-gammadeltaTCR→CauseOf→anti-gammadeltaTCR antibody tumor→ThemeOf→gammadelta T anti-gammadeltaTCR→ThemeOf→tumor tumor→ThemeOf→anti-gammadeltaTCR antibody anti-gammadeltaTCR→CauseOf→abrogated gammadelta T→ThemeOf→anti-gammadeltaTCR gammadelta T→ThemeOf→tumor gammadelta T→ThemeOf→abrogated anti-gammadeltaTCR antibody→ThemeOf→anti-gammadeltaTCR anti-gammadeltaTCR antibody→ThemeOf→tumor anti-gammadeltaTCR antibody→ThemeOf→abrogated anti-gammadeltaTCR→ThemeOf→gammadelta T tumor→ThemeOf→anti-gammadeltaTCR
472	35693762	8989	Vgamma9Vdelta2 T cells were also able to target glioma stem cells (GSCs).	Vgamma9Vdelta2→CauseOf→target
473	35693762	8998	Because the beneficial effect of gammadelta T cells in low-grade glioma (LGG) was clearer than HGG, gammadelta T cells may also have antitumor effects against other brain tumors, such as meningioma.	gammadelta T cells→CauseOf→beneficial gammadelta T cells→CauseOf→beneficial
474	35730767	10209	BACKGROUND: The soy isoflavone microbial metabolites dihydrodaidzein (DHD), dihydrogenistein (DHG), equol and 5-hydroxy-equol, are generally more biologically active than their precursors, daidzein and genistein.	dihydrodaidzein→CauseOf→more
475	35730767	10215	Moreover, the DPPH free radical-scavenging capacity of soymilk fermented with HAU-FR7 was significantly higher than that of unfermented soymilk.	HAU-FR7→ThemeOf→DPPH free radical-scavenging capacity HAU-FR7→CauseOf→higher DPPH free radical-scavenging capacity→ThemeOf→HAU-FR7 DPPH free radical-scavenging capacity→ThemeOf→higher
476	35812872	9031	Then the birds were all euthanized and evaluated using the WB myopathy scoring system based on the area of palpable firmness, reported by Sihvo et al.. For short, we manually palpated and classified 300 chicken filets into three kinds of breast filets based on the texture and firmness: normal breast (NORM), mild wooden breast (MILD), and severe wooden breast (SEV).	mild wooden breast→ThemeOf→firmness firmness→ThemeOf→MILD mild wooden breast→ThemeOf→firmness firmness→ThemeOf→WB myopathy mild wooden breast→ThemeOf→MILD MILD→ThemeOf→mild wooden breast mild wooden breast→ThemeOf→WB myopathy MILD→ThemeOf→firmness firmness→ThemeOf→mild wooden breast MILD→ThemeOf→firmness firmness→ThemeOf→firmness MILD→ThemeOf→WB myopathy firmness→ThemeOf→MILD WB myopathy→ThemeOf→mild wooden breast firmness→ThemeOf→WB myopathy WB myopathy→ThemeOf→firmness firmness→ThemeOf→mild wooden breast WB myopathy→ThemeOf→firmness firmness→ThemeOf→firmness WB myopathy→ThemeOf→MILD
477	35812872	9052	By contrast, the mean myofiber area and average myofiber width in SEV filets were lower than those in the NORM and MILD filets (P < 0.001).	average myofiber width→ThemeOf→SEV SEV→CauseOf→lower SEV→ThemeOf→average myofiber width SEV→ThemeOf→MILD MILD→ThemeOf→lower MILD→ThemeOf→SEV
478	35812872	9059	In addition, the abundance of Verrucomicrobia also decreased in birds with mild WB (P < 0.05, Figure 3D, right).	mild WB→CauseOf→decreased
479	35812872	9080	Hence, fragmented myofibers in severe WB was responsible for a bad water-holding capacity and other alternation in meat quality.	fragmented→CauseOf→bad
480	35812872	9092	Arginine was also reported to stimulate muscle protein synthesis by inducing the phosphorylation of mTOR in skeletal muscles.	mTOR→ThemeOf→stimulate Arginine→CauseOf→stimulate phosphorylation→ThemeOf→inducing mTOR→ThemeOf→muscle protein Arginine→ThemeOf→mTOR mTOR→ThemeOf→Arginine Arginine→ThemeOf→muscle protein mTOR→ThemeOf→inducing Arginine→CauseOf→inducing mTOR→ThemeOf→phosphorylation Arginine→ThemeOf→phosphorylation muscle protein→ThemeOf→stimulate inducing→CauseOf→stimulate muscle protein→ThemeOf→mTOR phosphorylation→ThemeOf→stimulate muscle protein→ThemeOf→Arginine phosphorylation→ThemeOf→mTOR muscle protein→ThemeOf→inducing phosphorylation→ThemeOf→muscle protein stimulate→CauseOf→inducing muscle protein→ThemeOf→phosphorylation phosphorylation→ThemeOf→Arginine
481	35812872	9096	The glutamine association with thyroid hormones regulates muscle weight and fiber diameter in resting and atrophic conditions and results in protection from muscle loss during atrophy.	atrophic conditions→ThemeOf→fiber diameter atrophy→ThemeOf→atrophic conditions fiber diameter→ThemeOf→regulates glutamine→ThemeOf→atrophic conditions atrophic conditions→ThemeOf→protection atrophy→ThemeOf→muscle protection→ThemeOf→glutamine glutamine→ThemeOf→muscle atrophic conditions→ThemeOf→regulates atrophy→ThemeOf→fiber diameter protection→ThemeOf→atrophic conditions glutamine→ThemeOf→atrophy muscle→ThemeOf→glutamine atrophy→ThemeOf→protection protection→ThemeOf→muscle glutamine→ThemeOf→fiber diameter muscle→ThemeOf→atrophic conditions atrophy→ThemeOf→regulates protection→ThemeOf→atrophy glutamine→ThemeOf→protection muscle→ThemeOf→atrophy fiber diameter→ThemeOf→glutamine protection→ThemeOf→fiber diameter glutamine→CauseOf→regulates muscle→ThemeOf→fiber diameter fiber diameter→ThemeOf→atrophic conditions protection→ThemeOf→regulates atrophic conditions→ThemeOf→glutamine muscle→ThemeOf→protection fiber diameter→ThemeOf→muscle atrophic conditions→ThemeOf→muscle muscle→ThemeOf→regulates fiber diameter→ThemeOf→atrophy atrophic conditions→ThemeOf→atrophy atrophy→ThemeOf→glutamine fiber diameter→ThemeOf→protection
482	35812872	9111	Choline, an essential nutrient for skeletal muscle, is a precursor of Ach, and ion replacement of K+ with choline+ results in potent inhibition of sarcoplasmic/endoplasmic reticulum Ca2+ ATPase in the sarcoplasmic/endoplasmic reticulum of skeletal muscles.	replacement→ThemeOf→Ca2+ replacement→CauseOf→inhibition replacement→ThemeOf→sarcoplasmic/endoplasmic reticulum sarcoplasmic/endoplasmic reticulum→ThemeOf→Ca2+ sarcoplasmic/endoplasmic reticulum→ThemeOf→replacement sarcoplasmic/endoplasmic reticulum→ThemeOf→inhibition Ca2+→ThemeOf→replacement Ca2+→ThemeOf→inhibition Ca2+→ThemeOf→sarcoplasmic/endoplasmic reticulum
483	36230139	9267	Some Lactobacilli have been reported as strains with high probiotic potential and support efforts to improve probiotic quality, such as L. salivarius strains BCRC14759 and BCRC 12574, with the highest exopolysaccharide production, L. johnsonii ZLJ010, with better adaptation to the gut environment and its probiotic functionalities, and L. helveticus D75 and D76 that can inhibit the growth of pathogens and pathobionts.	L. helveticus D75→CauseOf→inhibit BCRC14759→CauseOf→inhibit D75→CauseOf→inhibit
484	36230139	9317	Mutation breeding of Lactobacilli strains can change the genetic structure and function of Lactobacilli strains, and then screen mutants to obtain the required high-yield and high-quality strains.	Mutation→CauseOf→change Mutation→ThemeOf→genetic structure Mutation→ThemeOf→function genetic structure→ThemeOf→change genetic structure→ThemeOf→Mutation genetic structure→ThemeOf→function function→ThemeOf→change function→ThemeOf→Mutation function→ThemeOf→genetic structure
485	36557680	9621	With respect to the genome size, Weissella has a smaller pool of genes compared to other fecal commensal bacteria belonging to the genera Parabacteroides, Bacteroides, Lactobacillus, and Pediococcus.	Weissella→CauseOf→smaller Weissella→ThemeOf→pool pool→ThemeOf→Weissella pool→ThemeOf→smaller
486	36557680	9665	In addition, Weissella seems to play an important role in the reduction of a depression-like state and in the strengthening of the gut epithelial barrier.	strengthening→CauseOf→reduction Weissella→CauseOf→reduction Weissella→CauseOf→strengthening reduction→CauseOf→strengthening
487	36557680	9666	Among Weissella species, W. confusa is one of the most important EPS producers, and different W. confusa strains, such as W. confusa VP30, XG-3, and KR780676, produce several EPSs with distinct functions.	KR780676→CauseOf→produce KR780676→ThemeOf→EPS W. confusa→ThemeOf→EPS W. confusa→CauseOf→produce W. confusa→ThemeOf→EPS EPS→ThemeOf→KR780676 EPS→ThemeOf→EPS EPS→ThemeOf→produce EPS→ThemeOf→KR780676 EPS→ThemeOf→W. confusa EPS→ThemeOf→produce EPS→ThemeOf→EPS EPS→ThemeOf→W. confusa KR780676→ThemeOf→EPS
488	36557680	9687	The thermostable 'weissellicin D' exhibited a broad range of antibacterial activity against many food-borne pathogens, such as E. coli, S. aureus, and L. monocytogenes.	antibacterial→ThemeOf→'weissellicin D 'weissellicin D→ThemeOf→antibacterial
489	36557680	9697	Both weissellicin Y and weissellicin M possess broad antimicrobial spectra specifically targeted against B. coagulans.	weissellicin Y→ThemeOf→antimicrobial weissellicin M→ThemeOf→antimicrobial antimicrobial→ThemeOf→weissellicin Y antimicrobial→ThemeOf→weissellicin M
490	36557680	9698	Between the two, weissellicin M showed comparatively higher antibacterial activity, as well as greater acid and thermal stability when compared to weissellicin Y.	weissellicin M→CauseOf→higher weissellicin M→ThemeOf→antibacterial activity antibacterial activity→ThemeOf→higher antibacterial activity→ThemeOf→weissellicin M
491	36557680	9713	examined the antibacterial activity of W. confusa DD_A7 isolated from kimchi and found that the DD-A7 strains trigger the oxidative stress to inhibit the growth of extended-spectrum beta-lactamase (ESBL)-positive E. coli, which are emerging pathogens.	DD-A7→CauseOf→inhibit DD-A7→CauseOf→trigger inhibit→CauseOf→trigger trigger→CauseOf→inhibit
492	36557680	9733	For example, W. paramesenteroides WpK4 was able to reduce the disease activity index (DAI) as well as repair some of the mucosal damage in mice models with DSS-induced colitis.	WpK4→CauseOf→reduce reduce→CauseOf→repair W. paramesenteroides WpK4→CauseOf→repair W. paramesenteroides WpK4→CauseOf→reduce repair→CauseOf→reduce WpK4→CauseOf→repair
493	36677358	9885	Based on the VIP scores of PLS-DA (Figure 7B), zOTU_3 (Kluyveromyces marxianus) was highly associated with Kopanisti A, and zOTU_2 (Torulaspora delbrueckii) and zOTU_12 (Mucor circinelloides) with Kopanisti D, as also revealed by the compositional analysis at the genus level (Figure 6A).	zOTU_2→CauseOf→associated zOTU_3→CauseOf→associated
494	36677358	9892	Among the other three types, although not in a statistically significant mode, Kopanisti A received the highest score in structure and texture, Kopanisti C in flavour and appearance and Kopanisti D in aroma and after-taste.	texture→ThemeOf→structure aroma→CauseOf→Kopanisti appearance→ThemeOf→aroma flavour→ThemeOf→appearance Kopanisti→CauseOf→flavour after-taste→ThemeOf→structure structure→CauseOf→Kopanisti texture→CauseOf→Kopanisti aroma→ThemeOf→appearance appearance→ThemeOf→highest flavour→ThemeOf→highest Kopanisti→CauseOf→after-taste after-taste→CauseOf→Kopanisti Kopanisti→CauseOf→texture Kopanisti→CauseOf→texture aroma→ThemeOf→highest appearance→ThemeOf→flavour flavour→CauseOf→Kopanisti Kopanisti→CauseOf→structure structure→ThemeOf→texture Kopanisti→CauseOf→aroma texture→CauseOf→Kopanisti Kopanisti→CauseOf→aroma aroma→ThemeOf→flavour appearance→CauseOf→Kopanisti flavour→ThemeOf→after-taste after-taste→ThemeOf→texture structure→CauseOf→Kopanisti Kopanisti→CauseOf→appearance texture→ThemeOf→aroma Kopanisti→CauseOf→appearance aroma→CauseOf→Kopanisti appearance→ThemeOf→after-taste flavour→ThemeOf→structure after-taste→CauseOf→Kopanisti structure→ThemeOf→aroma Kopanisti→CauseOf→highest texture→ThemeOf→appearance Kopanisti→CauseOf→highest aroma→ThemeOf→after-taste appearance→ThemeOf→structure flavour→CauseOf→Kopanisti after-taste→ThemeOf→aroma structure→ThemeOf→appearance Kopanisti→CauseOf→flavour texture→ThemeOf→highest Kopanisti→CauseOf→flavour aroma→ThemeOf→structure appearance→CauseOf→Kopanisti Kopanisti→CauseOf→texture after-taste→ThemeOf→appearance structure→ThemeOf→highest Kopanisti→CauseOf→after-taste texture→ThemeOf→flavour Kopanisti→CauseOf→after-taste aroma→CauseOf→Kopanisti flavour→ThemeOf→texture Kopanisti→CauseOf→aroma after-taste→ThemeOf→highest structure→ThemeOf→flavour Kopanisti→CauseOf→structure texture→CauseOf→Kopanisti Kopanisti→CauseOf→structure appearance→ThemeOf→texture flavour→CauseOf→Kopanisti Kopanisti→CauseOf→appearance after-taste→ThemeOf→flavour structure→CauseOf→Kopanisti texture→ThemeOf→after-taste aroma→ThemeOf→texture appearance→CauseOf→Kopanisti flavour→ThemeOf→aroma Kopanisti→CauseOf→highest after-taste→CauseOf→Kopanisti structure→ThemeOf→after-taste
495	36766173	9942	In addition, butyrate esters contribute to the flavor of Baijiu, for example, phenylethyl butyrate has the aroma of floral, green with a tropical winey nuance; ethyl butyrate has the aroma of sweet, apple like, fresh and lifting, ethereal; isoamyl butyrate has the aroma of wax, green apple, fruit, sweet, berry; propyl butyrate has the aroma of sweet, bubble gum and pineapple like with a light green nuance; and isobutyl butyrate has sweet, fruity, pineapple, apple, bubble gum, and tropical fruit flavors.	propyl→ThemeOf→sweet sweet→ThemeOf→isoamyl sweet→ThemeOf→isobutyl butyrate sweet→ThemeOf→propyl isoamyl→ThemeOf→sweet isobutyl butyrate→ThemeOf→sweet
496	36766173	9950	For Clostridium, Clostridium sensu stricto 12, Clostridium sensu stricto 11, and Clostridium sensu stricto 1 were the dominant microorganisms, among which Clostridium sensu stricto 12 increased gradually in the early fermentation stage, while those of Clostridium sensu stricto 11 and Clostridium sensu stricto 1 increased and stabilized in the middle and late fermentation stages.	Clostridium→CauseOf→increased
497	36766173	9967	Among which, there were five positive interactions in the three genera of Lactobacillus, Weissella, and Lactococcus, while the fungal genus Saccharomyces showed significant positive interactions with four bacterial genera, including Lactobacillus, Weissella, Lactococcus, and Clostridium sensu strictto 12 (Figure 6b).	interactions→CauseOf→Weissella Weissella→CauseOf→interactions Weissella→CauseOf→positive Weissella→CauseOf→interactions interactions→ThemeOf→positive interactions→ThemeOf→interactions interactions→CauseOf→Weissella interactions→ThemeOf→interactions interactions→ThemeOf→positive
498	36766173	10006	Although the abundance of Monascus was lower than that of the other two fungal genera (Aspergillus and Saccharomyces), it also showed a contribution to most of the flavor compounds in all samples, especially in sample 4, Monascus was positively correlated with a20 (hexanoic acid, ethyl ester) (Figure 8c).	Monascus→CauseOf→correlated
499	36845507	10054	Among LAB, the genera Aerococcus, Carnobacterium, Enterococcus, Tetragenococcus, Lactobacillus, Pediococcus, Leuconostoc, Weissella, Lactococcus, and Streptococcus were detected in the commercial makgeolli samples.	Weissella→CauseOf→detected
500	36845507	10058	Among all LAB genera, the genus Lactobacillus was dominant, accounting for 55.76% of the LAB genera, followed by Leuconostoc (16.32%), Weissella (11.86%), Pediococcus (11.04%), and Lactococcus (4.02%).	Weissella→ThemeOf→Lactobacillus Pediococcus→ThemeOf→Weissella Weissella→ThemeOf→Lactococcus Pediococcus→ThemeOf→Lactobacillus Weissella→ThemeOf→Pediococcus Lactobacillus→ThemeOf→Weissella Lactobacillus→ThemeOf→Lactococcus Lactobacillus→ThemeOf→Pediococcus Leuconostoc→ThemeOf→Weissella Lactococcus→ThemeOf→Leuconostoc Leuconostoc→ThemeOf→Lactococcus Lactococcus→ThemeOf→Weissella Leuconostoc→ThemeOf→Pediococcus Lactococcus→ThemeOf→Lactobacillus Weissella→ThemeOf→Leuconostoc Pediococcus→ThemeOf→Leuconostoc
501	36845507	10059	Lactobacillus, the most abundant genus, accounted for an average of 32.61 +- 27.31% of the relative abundance in the makgeolli microbiome, followed by Leuconostoc, Weissella, and Pediococcus.	Weissella→ThemeOf→Pediococcus Weissella→ThemeOf→Leuconostoc Pediococcus→ThemeOf→Weissella Leuconostoc→ThemeOf→Weissella
502	36845507	10060	Similarly, the most frequent LAB genus detected in all samples was Lactobacillus, followed by Leuconostoc, Weissella, Lactococcus, and Pediococcus.	Lactococcus→ThemeOf→Weissella Leuconostoc→ThemeOf→Lactococcus Lactococcus→ThemeOf→Lactobacillus Leuconostoc→ThemeOf→Pediococcus Lactococcus→ThemeOf→Leuconostoc Lactobacillus→ThemeOf→Weissella Lactobacillus→ThemeOf→Lactococcus Lactobacillus→ThemeOf→Pediococcus Weissella→ThemeOf→Lactococcus Pediococcus→ThemeOf→Weissella Weissella→ThemeOf→Lactobacillus Pediococcus→ThemeOf→Lactobacillus Weissella→ThemeOf→Pediococcus Pediococcus→ThemeOf→Leuconostoc Weissella→ThemeOf→Leuconostoc Leuconostoc→ThemeOf→Weissella
503	36845507	10069	3a shows that the commercial makgeolli products prepared using nuruk demonstrated a higher relative abundance of the genera Pediococcus and Leuconostoc and a lower relative abundance of the genus Streptococcus compared to that in the samples without nuruk.	genera→ThemeOf→higher Pediococcus→ThemeOf→relative abundance nuruk→CauseOf→higher Leuconostoc→ThemeOf→genera genera→ThemeOf→relative abundance Pediococcus→CauseOf→nuruk nuruk→ThemeOf→relative abundance Leuconostoc→ThemeOf→relative abundance higher→CauseOf→lower genera→ThemeOf→Pediococcus Pediococcus→ThemeOf→lower nuruk→CauseOf→genera Leuconostoc→CauseOf→nuruk relative abundance→ThemeOf→higher genera→ThemeOf→relative abundance relative abundance→ThemeOf→higher nuruk→CauseOf→Pediococcus Leuconostoc→ThemeOf→lower relative abundance→ThemeOf→genera genera→CauseOf→nuruk relative abundance→ThemeOf→relative abundance nuruk→ThemeOf→relative abundance relative abundance→ThemeOf→Pediococcus genera→ThemeOf→lower relative abundance→ThemeOf→genera nuruk→CauseOf→lower relative abundance→ThemeOf→relative abundance genera→ThemeOf→Leuconostoc relative abundance→ThemeOf→Pediococcus nuruk→CauseOf→Leuconostoc relative abundance→ThemeOf→nuruk Pediococcus→ThemeOf→higher relative abundance→ThemeOf→nuruk lower→CauseOf→higher Pediococcus→ThemeOf→relative abundance Leuconostoc→ThemeOf→higher relative abundance→ThemeOf→Leuconostoc Pediococcus→ThemeOf→genera relative abundance→ThemeOf→Leuconostoc Leuconostoc→ThemeOf→relative abundance
504	36845507	10078	Notably, 18 species were reported for the first time in rice wine, including Carnobacterium viridans, Enterococcus casseliflavus, Tetragenococcus halophilus, Lactobacillus hamsteri, Lactobacillus helveticus, Lactobacillus manihotivorans, Lactobacillus paralimentarius, Lactobacillus paraplantarum, Lactobacillus pontis, Lactobacillus zeae, Pediococcus ethanolidurans, Leuconostoc fallax, Weissella beninensis, Weissella ghanensis, Weissella hellenica, Weissella viridescens, Lactococcus garvieae, and Streptococcus luteciae.	Weissella hellenica→ThemeOf→Lactococcus Lactococcus→ThemeOf→Weissella hellenica Lactococcus→ThemeOf→Weissella viridescens Weissella viridescens→ThemeOf→Lactococcus
505	36845507	10083	According to Chai et al., LAB genera dominated the makgeolli system from day 2, with the population shifting complementarily between Pediococcus and Weissella.	makgeolli→ThemeOf→Weissella Weissella→ThemeOf→makgeolli
506	36845507	10088	In addition, some strains of Enterococcus casseliflavus, Tetragenococcus halophilus, Lactobacillus delbrueckii, Lactobacillus paraplantarum, Lactobacillus zeae, Pediococcus acidilactici, Leuconostoc mesenteroides, Weissella hellenica, Weissella paramesenteroides, and Lactococcus garvieae, which were detected in this study, have been reported to possess probiotic potential.	Weissella→CauseOf→Enterococcus Weissella→CauseOf→Lactococcus Enterococcus→CauseOf→Weissella Enterococcus→CauseOf→Weissella Weissella→CauseOf→Enterococcus Weissella→CauseOf→Lactococcus Lactococcus→CauseOf→Weissella Lactococcus→CauseOf→Weissella
507	36981219	4	In addition, certain LAB strains are capable of transforming isoflavone aglycones into compounds with a greater biological activity, such as dihydrodaidzein (DHD), O-desmethylangolensin (O-DMA), dihydrogenistein (DHG) and 6-hydroxy-O-desmethylangolensin (6-OH-O-DMA).	O-desmethylangolensin→ThemeOf→dihydrodaidzein biological activity→ThemeOf→O-desmethylangolensin DHG→ThemeOf→O-desmethylangolensin O-desmethylangolensin→ThemeOf→biological activity biological activity→ThemeOf→dihydrodaidzein DHG→ThemeOf→dihydrodaidzein O-desmethylangolensin→ThemeOf→6-hydroxy-O-desmethylangolensin biological activity→ThemeOf→6-hydroxy-O-desmethylangolensin DHG→ThemeOf→biological activity O-desmethylangolensin→ThemeOf→transforming biological activity→ThemeOf→transforming DHG→ThemeOf→6-hydroxy-O-desmethylangolensin O-desmethylangolensin→ThemeOf→DHG biological activity→ThemeOf→DHG DHG→CauseOf→transforming dihydrodaidzein→ThemeOf→O-desmethylangolensin 6-hydroxy-O-desmethylangolensin→ThemeOf→O-desmethylangolensin dihydrodaidzein→ThemeOf→biological activity 6-hydroxy-O-desmethylangolensin→ThemeOf→dihydrodaidzein dihydrodaidzein→ThemeOf→6-hydroxy-O-desmethylangolensin 6-hydroxy-O-desmethylangolensin→ThemeOf→biological activity dihydrodaidzein→ThemeOf→transforming 6-hydroxy-O-desmethylangolensin→ThemeOf→transforming dihydrodaidzein→ThemeOf→DHG 6-hydroxy-O-desmethylangolensin→ThemeOf→DHG
508	36981219	6	Another strategy in the bioconversion of isoflavones is the heterologous expression of genes from Slackia isoflavoniconvertens DSM22006, which have allowed the production of DHD, DHG, equol and 5-hydroxy-equol in high concentrations by engineered LAB strains.	5-hydroxy-equol→ThemeOf→production DSM22006→ThemeOf→DHD equol→ThemeOf→5-hydroxy-equol production→ThemeOf→equol DHG→ThemeOf→allowed DSM22006→ThemeOf→equol equol→ThemeOf→DHG DHG→ThemeOf→5-hydroxy-equol DSM22006→ThemeOf→production equol→ThemeOf→DSM22006 DHG→ThemeOf→DSM22006 DHD→ThemeOf→allowed equol→ThemeOf→DHD DHG→ThemeOf→DHD DHD→ThemeOf→5-hydroxy-equol equol→ThemeOf→production 5-hydroxy-equol→ThemeOf→allowed DHG→ThemeOf→equol DHD→ThemeOf→DHG production→ThemeOf→allowed 5-hydroxy-equol→ThemeOf→DHG DHG→ThemeOf→production DHD→ThemeOf→DSM22006 production→ThemeOf→5-hydroxy-equol 5-hydroxy-equol→ThemeOf→DSM22006 DSM22006→CauseOf→allowed DHD→ThemeOf→equol production→ThemeOf→DHG 5-hydroxy-equol→ThemeOf→DHD DSM22006→ThemeOf→5-hydroxy-equol DHD→ThemeOf→production production→ThemeOf→DSM22006 5-hydroxy-equol→ThemeOf→equol DSM22006→ThemeOf→DHG equol→ThemeOf→allowed production→ThemeOf→DHD
509	36981219	40	Daidzein and genistein aglycones can be transformed into DHD and DHG, respectively, by hydrogenation reactions (Figure 2 and Figure 3).	genistein→ThemeOf→DHD genistein→ThemeOf→transformed genistein→ThemeOf→DHG DHD→ThemeOf→genistein DHD→CauseOf→transformed DHG→ThemeOf→genistein DHG→CauseOf→transformed
510	36981219	47	Recently, we observed that O-DMA and 6-OH-O-DMA were metabolized mainly from daidzein and genistein by LAB strains through fission of the C-ring, although O-DMA and 6-OH-O-DMA could also be produced from DHD and DHG with lower efficiency.	O-DMA→CauseOf→metabolized metabolized→CauseOf→O-DMA
511	36981219	49	DHD and DHG must be transformed into tetrahydrodaidzein (THD) and tetrahydrogenistein (THG) for their subsequent transformation into equol and 5-hydroxy-equol (5-OH-equol), respectively.	DHD→ThemeOf→tetrahydrodaidzein THD→ThemeOf→DHG DHD→ThemeOf→THD THD→ThemeOf→DHD equol→ThemeOf→DHG THD→ThemeOf→equol equol→ThemeOf→DHD THD→ThemeOf→tetrahydrodaidzein equol→ThemeOf→tetrahydrodaidzein equol→ThemeOf→THD DHG→ThemeOf→equol tetrahydrodaidzein→ThemeOf→DHG DHG→ThemeOf→tetrahydrodaidzein tetrahydrodaidzein→ThemeOf→DHD DHG→ThemeOf→THD tetrahydrodaidzein→ThemeOf→equol DHD→ThemeOf→equol tetrahydrodaidzein→ThemeOf→THD
512	36981219	66	LAB harboring pNZ:TuR.gly913 or pLEB590.gly913 (a food grade vector), both including gly913 under the promoter of elongation factor Tu of L. reuteri CECT 925, improved the ability to transform glycoside isoflavones into their aglycones.	transform glycoside isoflavones→CauseOf→gly913 gly913→CauseOf→improved gly913→CauseOf→transform glycoside isoflavones
513	36981219	75	Since both DHD and DHG are bioactive isoflavones and can promote the production of equol and 5-OH-equol in equol producing individuals, it would be of interest to produce both DHD and DHG in high concentrations.	DHG→ThemeOf→production of equol production of equol→ThemeOf→DHD DHD→CauseOf→promote production of equol→ThemeOf→5-OH-equol DHD→ThemeOf→5-OH-equol DHD→ThemeOf→production of equol 5-OH-equol→ThemeOf→promote 5-OH-equol→ThemeOf→DHG 5-OH-equol→ThemeOf→DHD 5-OH-equol→ThemeOf→production of equol DHG→CauseOf→promote production of equol→ThemeOf→promote DHG→ThemeOf→5-OH-equol production of equol→ThemeOf→DHG
514	36981219	83	Likewise, the co-fermentation of soy beverages with the engineered L. fermentum INIA P584L harboring dzr, ddr and tdr and Bifidobacterium pseudocatenulatum INIA P815, a bacteria with high glycosidase activity, allowed the production of equol and 5-OH-equol (Figure 4B).	ddr→CauseOf→allowed dzr→CauseOf→allowed
515	36981219	92	In this sense, soy beverages fermented by L. paracasei NTU 101 was effective in preventing hyperlipidemia and atherosclerosis.	NTU 101→ThemeOf→L. paracasei hyperlipidemia→ThemeOf→atherosclerosis NTU 101→ThemeOf→atherosclerosis NTU 101→ThemeOf→hyperlipidemia atherosclerosis→ThemeOf→preventing atherosclerosis→ThemeOf→L. paracasei L. paracasei→CauseOf→preventing atherosclerosis→ThemeOf→NTU 101 L. paracasei→ThemeOf→NTU 101 atherosclerosis→ThemeOf→hyperlipidemia L. paracasei→ThemeOf→atherosclerosis hyperlipidemia→ThemeOf→preventing L. paracasei→ThemeOf→hyperlipidemia hyperlipidemia→ThemeOf→L. paracasei NTU 101→ThemeOf→preventing hyperlipidemia→ThemeOf→NTU 101
516	36981219	94	In addition to the improvement in their bioavailability, the increased antioxidative activity of fermented soy food is attributed primarily to bioactive isoflavones, such as daidzein and genistein produced from isoflavones present in soy foods, although other factors, such as the production of bioactive peptides, have been also described.	daidzein→CauseOf→increased
517	36981219	103	Therefore, the estrogenic activity of O-DMA and equol is higher than that of daidzein because O-DMA and equol are able to activate the binding of both ERbeta and ERalpha to the estrogen response element better than diadzein.	O-DMA→CauseOf→binding O-DMA→CauseOf→higher higher→CauseOf→activate O-DMA→CauseOf→activate activate→CauseOf→higher binding→CauseOf→O-DMA
518	36981219	112	Similarly, genistein, through the inhibition of the master regulatory transcription factors GATA-3 and STAT-6, decreased airway inflammation associated with Th2-type cytokines in a murine asthmatic model.	decreased→CauseOf→inhibition genistein→CauseOf→decreased genistein→CauseOf→inhibition inhibition→CauseOf→decreased
519	36981219	114	Moreover, daidzein induces apoptosis in hepatic cancer cells via the mitochondrial pathway.	daidzein→CauseOf→induces hepatic cancer→ThemeOf→daidzein hepatic cancer→ThemeOf→induces daidzein→ThemeOf→hepatic cancer
520	36981219	117	Additionally, the presence of equol and O-DMA has been associated with the inhibition of cancer cell proliferation and a chemoprotective role in the prevention of several cancers.	O-DMA→CauseOf→inhibition equol→CauseOf→inhibition presence→CauseOf→inhibition

AGAC Chain for L.acidipiscis